Buscar en
Revista Argentina de Microbiología
Toda la web
Inicio Revista Argentina de Microbiología First nosocomial outbreak of SME-4-producing Serratia marcescens in South Americ...
Información de la revista
Vol. 55. Núm. 3.
Páginas 251-254 (Julio - Septiembre 2023)
Compartir
Compartir
Descargar PDF
Más opciones de artículo
Visitas
581
Vol. 55. Núm. 3.
Páginas 251-254 (Julio - Septiembre 2023)
Brief report
Acceso a texto completo
First nosocomial outbreak of SME-4-producing Serratia marcescens in South America
Primer brote nosocomial por Serratia marcescens productora de SME-4 en Sudamérica
Visitas
581
Juana Vegaa,c,,
Autor para correspondencia
juanavega24@gmail.com

Corresponding authors.
, Carlos H. Rodriguezb, Ignacio Viscardia, Carlos Vayb, Silvina Torresa, Emilce Tabaresa, Angela Famigliettib, Marcela Nastrob,,
Autor para correspondencia
marcelanastro@hotmail.com

Corresponding authors.
a Servicio de Microbiologia, Departamento de Bioquimica, Hospital General 601-Hospital Militar Central “Cir My Dr Cosme Argerich”, Argentina
b Laboratorio de Bacteriología, Departamento de Bioquímica Clínica, Hospital de Clínicas José de San Martín, Facultad de Farmacia y Bioquímica, INFIBIOC, UBA, Argentina
c Laboratorio de Bacteriología, Departamento de Bioquímica Clínica, Hospital de Clínicas José de San Martín, Facultad de Farmacia y Bioquímica, UBA, Argentina
Highlights

  • Serratia marcescens represents a nosocomial pathogen worldwide.

  • First description of a nosocomial outbreak by SME-4 in South America.

  • Class A carbapenemases different from KPC may be underestimated.

Este artículo ha recibido
Información del artículo
Resumen
Texto completo
Bibliografía
Descargar PDF
Estadísticas
Figuras (1)
Tablas (2)
Table 1. Demographic and molecular data of Serratia marcescens isolates.
Table 2. Susceptibility profile of S. marcescens isolates.
Mostrar másMostrar menos
Abstract

Carbapenemase-producing-Serratia marcescens isolates, although infrequent, are considered important nosocomial pathogens due to their intrinsic resistance to polymyxins, which limits therapeutic options. We describe a nosocomial outbreak of SME-4-producing S. marcescens in Buenos Aires city which, in our knowledge, represents the first one in South America.

Keywords:
SME-4
Nosocomial outbreak
Carbapenemases
Resumen

Los aislamientos de origen nosocomial de Serratia marcescens productores de carbapenemasa, si bien son infrecuentes, son considerados importantes patógenos debido a su resistencia intrínseca a las polimixinas, lo cual limita aún más las opciones terapéuticas. En este trabajo se describe un brote nosocomial causado por S. marcescens portadora de carbapenemasa de tipo SME-4 en la Ciudad de Buenos Aires, el cual representaría el primero en Sudamérica.

Palabras clave:
SME-4
Brote nosocomial
Carbapenemasas
Texto completo

Serratia marcescens is an opportunistic pathogen responsible for severe infections and nosocomial outbreaks. Although it does not carry acquired carbapenemase genes as frequently as other Enterobacterales such as Klebsiella pneumoniae, there are reports of KPC or MBL producing S. marcescens isolates worldwide6 and in Argentina5,11.

SME serine enzymes are chromosomally-encoded and have been exclusively reported in S. marcescens isolates. They confer resistance to carbapenems but remain susceptible to extended spectrum cephalosporins and are inhibited by classical (clavulanic acid) and new inhibitors1. To date, five SME variants (SME-1, -2, -3, -4 and -5) have been reported worldwide causing sporadic reports after their first detection in England in 19822,10,13. The first SME-4 variant was reported by the USA in Genbank under accession number KF481967; however, it has not been published yet. In South America, two clinical isolates were reported, one in Brazil in 20173 and the other when our research group reported the first case in Argentina4 in 2019. In the present study, we describe a nosocomial outbreak of SME-4 producing S. marcescens in a public hospital of Buenos Aires city, Argentina, during the SARS-CoV-2 pandemic.

Samples belonging to four patients admitted to the Intensive Care Unit (ICU) at Hospital Militar Central Cosme Argerich of Buenos Aires city, in June 2021 were studied. The study was approved by the Ethics Committee of Hospital de Clínicas Jose de San Martin, Argentina. S. marcescens was recovered in the five isolates, of these, four (one isolate belonging to each patient) were subjected to further analysis as shown in Table 1. Identification was determined by matrix-assisted laser desorption and ionization time-of-flight mass spectrometry (MALDI-TOF MS) and the Vitek-2 system (VITEK®2 GN) (VITEK®2 AST-N368), which was also used to perform the susceptibility testing of the isolates, according to the manufacturer's recommendations. Results were interpreted following the CLSI 2021 guidelines. A confirmatory test for detection of non-KPC class A carbapenemases with amoxicillin clavulanic (AMC) acid, was performed, as well as the Blue-Carba test12 (Fig. 1).

Table 1.

Demographic and molecular data of Serratia marcescens isolates.

Patient  Isolate  Enzyme  REP PCR-pattern  Date  Clinical specimen  Underlying diseases  Previous treatment  Outcome 
Sm1  SME-4  4–7/6  TA, blood  SARS-CoV-2  MER, COLPTZ, LZD  Death 
Sm2  SME-4  9/6  TA  SARS-CoV-2, dyslipidemia, smoking  MER, COL, AMS, VA  Favorable 
Sm3  SME-4  22/6  TA  SARS-CoV-2, cancer, hypercholesterolemia, cardiovascular disease  MER, COL, AMC  Death 
Sm4  SME-4  25/6  TA  SARS-CoV-2, obesity, hypothyroidism  MER, COL, AMC, CLA  Death 

TA: tracheal aspirate; AMS: ampicillin sulbactam; AMC: amoxicillin/clavulanic acid; CLA: clarithromycin; VA: vancomycin; PTZ: piperacillin–tazobactam; LZD: linezolid; MER: meropenem; COL: colistin.

Figure 1.

Phenotypic detection of SME-4. Double disc-synergy test: boronic acid (300μg)–imipenem (10μg) and imipenem (30μg)–amoxicillin clavulanic acid (30μg).

(0,07MB).

Total DNA from the four isolates was extracted using the QIAamp DNA minikit (Qiagen, Les Ulis, France) following the manufacturer's instructions. The presence of blaSME was investigated by PCR using specific primers (SME-1A: AGGAAGACTTTGATGGGAGG and SME-1B: GGCCAAATGACGGCATAATC), which amplify an internal region of the gene, covering the 5 allelic variants described to date, followed by sequencing (Macrogen Inc., Seoul, Korea). Molecular typing was performed by REP-PCR14. A previous S. marcescens isolate harboring the SME-4 enzyme (Sm163) was included in the molecular tests as positive control4, whereas an unrelated S. marcescens isolate was included as a negative control strain (NT strain).

The four patients were admitted to the ICU with SARS-CoV-2 pneumonia in the same month. Demographic information about the isolates is detailed in Table 1.

Sm1, Sm2, Sm3 and Sm4 showed the same susceptibility profile, which is detailed in Table 2. Carbapenem resistance and susceptibility to extended spectrum cephalosporins raised the alarm about a possible chromosomal class A carbapenemase that was detected phenotypically by the Blue-Carba test and the IMI-AMC-MER synergy test, which was positive in all the isolates. PCR amplification followed by sequencing of the SME gene confirmed the presence of the SME-4 variant. The four isolates displayed indistinguishable REP-PCR fingerprints (different from the NT strain pattern) confirming the suspicion of a nosocomial outbreak; the same pattern was also observed in control strain Sm163, which would suggest the possibility of a silent spread of a clone in our region.

Table 2.

Susceptibility profile of S. marcescens isolates.

Antimicrobial agent  MIC (μg/ml)
  Sm1,2,3,4**  Interpretation  Sm163*  Interpretation 
Ampicillin  ≥32  >16 
Amoxicillin/clavulanic  ≥32  >16 
Piperacillin/tazobactam  ≤4  16/4 
Cefazolin  ≥64  >8 
Cefoxitin  ≤1  >16 
Cefotaxime  ≤1  NT   
Ceftriaxone  ≤1 
Ceftazidime  ≤1  ≤2 
Cefepime  ≤1 
Ertapenem  NT    >1 
Imipenem  ≥16  >8 
Meropenem  ≥16  >8 
Amikacin  ≤2  ≤8 
Gentamicin  ≤1 
Trimethoprim/sulfamethoxazole  ≤20  ≤0.5/9.5 
Ciprofloxacin  ≤0.25  0.5 
Colistin  ≥16  >4 
Fosfomycin  NT    >64 

R: resistant; S: susceptible; NT: not tested.

*

Phoenix system.

**

Vitek system.

The fact that the susceptibility profile of these isolates differs from the one observed in the most prevalent carbapenemases such as KPC or NDM makes its detection a challenge for clinical laboratories. Variability in susceptibility to meropenem and ertapenem has been described by some authors, together with the misdetection observed with some commercial phenotypic tests8. Considering that rapid molecular assays, such as the blaSME gene, are not included in the routine tests available, we should be aware of the need to perform single gene PCR testing when observing these unusual resistance profiles to avoid a possible underestimation of this resistance mechanism.

Outbreaks of S. marcescens carrying SME variants are very infrequent; except for Hopkins’ communication of seven isolates belonging to three patients in different areas of England8 and two clonally related isolates from two patients in different hospitals in Detroit7, only sporadic reports of SME-producing single isolates have been published. All SME-4 carriers reported so far have shown this enzyme to be chromosomally-encoded and the absence of S. marcescens successful clones adapted to the hospital setting may contribute to this epidemiological profile. However, the finding of these isolates should be communicated to prevent future clonal spreads. In this particular case, infection control measures to prevent the future spread of the mechanism of resistance were implemented in the Intensive Care Unit; they included isolation in separate rooms, surveillance cultures and antimicrobial therapy.

The first S. marcescens isolates carrying SME-4 in our country were recovered from both a surveillance rectal swab and a catheter blood culture from a patient attended at the University hospital of Buenos Aires city in the year 2016. The molecular studies performed on that isolate showed that the blaSME-4 gene was located on a SmarGI1-1-like genomic island that may contribute to the mobilization of this gene among different S. marcescens isolates4,9. No epidemiological link was found between the outbreak described in the present study and the previous clinical finding. Furthermore, it is of note that during these five years there had not been any reports of S. marcescens isolates with a similar phenotypic and genotypic profile in Argentina.

In the present work we describe the first nosocomial outbreak of four SME-4 producing S. marcescens isolates belonging to four patients in South America, which also represents the most extensive outbreak worldwide. We emphasize the need to be aware of the detection of these infrequent isolates to prevent the silent spread of this resistance mechanism in this nosocomial pathogen which represents a concern for clinicians due to the limited therapeutic options available.

Ethical approval

This work was carried out with bacterial isolates of clinical origin. All procedures performed in the study met the ethical standards of Hospital de Clinicas Jose de San Martin, B.A, Argentina (project UBACyT 20020130100167BA to Angela Famiglietti) and the 1964 Declaration of Helsinki and further amendments.

Funding

This work was supported by UBACyT20020130100167BA to Angela Famiglietti.

Conflict of interest

None to declare.

References
[1]
M. Biagi, A. Shajee, A. Vialichka, M. Jurkovic, X. Tan, E. Wenzler.
Activity of imipenem–relebactam and meropenem–vaborbactam against carbapenem-resistant SME-producing Serratia marcescens.
Antimicrob Agents Chemother, 64 (2020),
[2]
K. Bush, P.A. Bradford.
Epidemiology of β-lactamase-producing pathogens.
Clin Microbiol Rev, 33 (2020),
[3]
R. Cayô, R.C. Leme, A.P. Streling, A.P. Matos, C.S. Nodari, J.R. Chaves, J.L. Brandão, M.F. de Almeida, V. Carrareto, M.A. de Castro Pereira, J.P. de Almeida, D.C. Ferreira, A.C. Gales.
Serratia marcescens harboring SME-4 in Brazil: a silent threat.
Diagn Microbiol Infect Dis, 87 (2017), pp. 357-358
[4]
L. Dabos, R. Patiño-Navarrete, M. Nastro, A. Famiglietti, P. Glaser, C.H. Rodriguez, T. Naas.
SME-4-producing Serratia marcescens from Argentina belonging to clade 2 of the S. marcescens phylogeny.
J Antimicrob Chemother, 74 (2019), pp. 1836-1841
[5]
D. De Belder, C. Lucero, M. Rapoport, A. Rosato, D. Faccone, A. Petroni, F. Pasteran, E. Albornoz, A. Corso, S.A. Gomez.
Genetic diversity of KPC-producing Escherichia coli, Klebsiella oxytoca, Serratia marcescens, and Citrobacter freundii isolates from Argentina.
Microb Drug Resist, 24 (2018), pp. 958-965
[6]
L.M. Deshpande, P.R. Rhomberg, H.S. Sader, R.N. Jones.
Emergence of serine carbapenemases (KPC and SME) among clinical strains of Enterobacteriaceae isolated in the United States Medical Centers: report from the MYSTIC Program (1999–2005).
Diagn Microbiol Infect Dis, 56 (2006), pp. 367-372
[7]
M.R. Fairfax, A.M. Queenan, P.R. Lephart, K.S. Kaye, M. Dror, N. Arnous, T.T. Salimnia, R.A. Mitchell, G. Alangaden, H. Salimnia.
Detection of 2 SME-1 carbapenemase-producing Serratia marcescens in Detroit.
Diagn Microbiol Infect Dis, 71 (2011), pp. 325-326
[8]
K.L. Hopkins, J. Findlay, D. Meunier, M. Cummins, S. Curtis, I. Kustos, N. Mustafa, C. Perry, R. Pike, N. Woodford.
Serratia marcescens producing SME carbapenemases: an emerging resistance problem in the UK?.
J Antimicrob Chemother, 72 (2017), pp. 1535-1537
[9]
L.F. Mataseje, D.A. Boyd, J. Delport, L. Hoang, M. Imperial, B. Lefebvre, M. Kuhn, P. Van Caeseele, B.M. Willey, M.R. Mulvey.
Serratia marcescens harbouring SME-type class A carbapenemases in Canada and the presence of blaSME on a novel genomic island, SmarGI1-1.
J Antimicrob Chemother, 69 (2014), pp. 1825-1829
[10]
T. Naas, L. Vandel, W. Sougakoff, D.M. Livermore, P. Nordmann.
Cloning and sequence analysis of the gene for a carbapenem-hydrolyzing class A beta-lactamase Sme-1, from Serratia marcescens.
Antimicrob Agents Chemother, 38 (1994), pp. 1262-1270
[11]
M. Nastro, R. Monge, J. Zintgraff, L.G. Vaulet, M. Boutureira, A. Famiglietti, C.H. Rodriguez.
First nosocomial outbreak of VIM-16-producing Serratia marcescens in Argentina.
Clin Microbiol Infect, 19 (2013), pp. 617-619
[12]
J. Pires, A. Novais, L. Peixe.
Blue-carba, an easy biochemical test for detection of diverse carbapenemase producers directly from bacterial cultures.
J Clin Microbiol, 51 (2013), pp. 4281-4283
[13]
A.M. Queenan, W. Shang, P. Schreckenberger, K. Lolans, K. Bush, J. Quinn.
SME-3, a novel member of the Serratia marcescens SME family of carbapenem-hydrolyzing beta-lactamases.
Antimicrob Agents Chemother, 50 (2006), pp. 3485-3487
[14]
G. Singh, M. Biswal, V. Hallur, K.L. Rao, P. Ray, V. Gautam, S.B. Appannanavar, N. Taneja.
Utility of whole-cell repetitive extragenic palindromic sequence-based PCR (REP-PCR) for the rapid detection of nosocomial outbreaks of multidrug resistant organisms: experience at a tertiary care center in North India.
Indian J Med Microbiol, 33 (2015), pp. 221-224

These authors contributed equally to this study.

Copyright © 2023. Asociación Argentina de Microbiología
Opciones de artículo
Herramientas
es en pt

¿Es usted profesional sanitario apto para prescribir o dispensar medicamentos?

Are you a health professional able to prescribe or dispense drugs?

Você é um profissional de saúde habilitado a prescrever ou dispensar medicamentos