metricas
covid
Buscar en
Revista Argentina de Microbiología
Toda la web
Inicio Revista Argentina de Microbiología Cladosporium species causing “Cladosporium rot” on “Bosc” pear fruit in ...
Información de la revista
Vol. 53. Núm. 1.
Páginas 75-77 (Enero - Marzo 2021)
Compartir
Compartir
Descargar PDF
Más opciones de artículo
Visitas
1573
Vol. 53. Núm. 1.
Páginas 75-77 (Enero - Marzo 2021)
Brief report
Open Access
Cladosporium species causing “Cladosporium rot” on “Bosc” pear fruit in Argentina
Especies de Cladosporium causantes de podredumbre en peras «Bosc» en Argentina
Visitas
1573
Temperini Carolina Virginiaa,
Autor para correspondencia
ctemperini@unrn.edu.ar

Corresponding author.
, Alonso Javier Néstora,c, Colodner Adrián Dariob, Pose Graciela Noemía,c,1
a Universidad Nacional de Río Negro, Río Negro, Argentina. Mitre 331, (8336) Villa Regina, Provincia de Río Negro, Argentina
b Instituto Nacional de Tecnología Agropecuaria (INTA) - Estación Experimental Agropecuaria Alto Valle. Ruta Nacional 22, Km 1190, (8332) Allen, Río Negro
c Consejo Nacional de Investigaciones Científicas y Tecnológicas (CONICET), Argentina
Highlights

  • Cladosporium rot on Bosc pears has been reported in the valleys of Río Negro and Neuquén.

  • Cladosporium macrocarpum, C. subtilissimum and C. floccosum were the species involved.

  • This is the first report of identified Cladosporium species as involved in this pathology.

Este artículo ha recibido

Under a Creative Commons license
Información del artículo
Resumen
Texto completo
Bibliografía
Descargar PDF
Estadísticas
Figuras (1)
Abstract

Cladosporium rot” on “Bosc” pear fruit during cold storage causes significant economic losses and has been reported in recent years in the productive valleys of Río Negro and Neuquén. The species involved were not determined. During 2016-2017, “Bosc” pears (Pyrus communis) in cold storage chambers exhibited external brownish black circular spots caused by Cladosporium spp. The objective of this work was to determine the Cladosporium species that caused the above mentioned symptoms. The morphological and molecular analyses of the partial sequence of the actin gene (ACT) supported the identification. Cladosporium macrocarpum, Cladosporium subtilissimum and Cladosporium floccosum were determined as the species involved in the disease. Although Cladosporium has been reported to cause pear rot, this is the first report to identify these species as causal agents of this fruit disease.

Keywords:
Cladosporium rot
Rot spot
“Bosc” pear fruit
Pyrus communis
Resumen

En los valles productivos de Río Negro y Neuquén, se ha reportado en los últimos años la presencia de podredumbre de peras «Bosc» causada por Cladosporium, lo que generó significativas pérdidas económicas. Las especies involucradas no fueron determinadas. Se detectó la aparición de manchas circulares negras parduzcas en peras de dicha variedad en cámaras de almacenamiento en frío durante 2016-2017. El objetivo del presente trabajo fue determinar las especies de Cladosporium causantes de los síntomas mencionados. La identificación fue llevada a cabo por caracterización morfológica y el análisis molecular de la secuencia parcial del gen de actina (ACT). Se pudo determinar que Cladosporium macrocarpum, Cladosporium subtilissimum y Cladosporium floccosum fueron las especies implicadas. Si bien la podredumbre en peras causada por Cladosporium ha sido previamente reportada, este es el primer informe que identifica a estas especies entre los agentes causales de la enfermedad.

Palabras clave:
Pudrición por Cladosporium
Manchas por pudrición
Peras «Bosc»
Pyrus communis
Texto completo

Cladosporium species can cause lesions in healthy pears according to in vitro studies5,7,14. Cladosporium herbarum was reported as a causal agent of Cladosporium rot on Bosc pear cultivars in the USA9. Moreover, the species C. herbarum and Cladosporium sp. were reported as postharvest phytopathogens of pears in the Netherlands15. Postharvest Cladosporium rots were also reported in Argentina on Beurré Bosc and Golden Russet Bosc pears in Northern Patagonia5,12. A correct and accurate identification of the species is necessary because the name of the species involves a set of characteristics such as growth features, pathogenicity or production of mycotoxins, which allow to predict their behavior1.

“Bosc” pears were affected by rot spots during cold storage (2016-2017) in the High Valley of Río Negro, a fruit producing region of Northern Patagonia in Argentina. The symptoms consisted of one or more brownish black circular spots that extended over the rind, light brown on the edges and dark brown to black in the center (Fig. 1). Therefore, the objective of this work was to determine the Cladosporium species that were involved in this fruit disease.

Figure 1.

External symptoms of Cladosporium rot on Bosc pears.

(0,04MB).

Fifteen symptomatic “Bosc” pears, stored unprocessed during approximately 2 months in bins inside conventional cold storage chambers at -0.5°C, were obtained from three commercial establishments (5 pieces from each). Fruits were superficially disinfected with a solution of sodium hypochlorite (1:10) for 5minutes and rinsed by immersion twice in sterile distilled water. Infected internal tissue fragments were aseptically extracted from the spots and placed on potato dextrose agar supplemented with 0.1% chloramphenicol (PDA+C). Plates were incubated for 7 days at 25°C. The pathogens were identified at the genus level according to Pitt and Hocking8 as Cladosporium species. Characterization based on macroscopic features of the colonies clustered the isolates into nine different morphological groups (designated as G1 to G9). The microscopic characteristics of the isolates were determined in SNA (synthetic nutrient-poor agar) medium after 14 days of incubation at 25°C under close UV light3. DNA extraction was performed using the DNeasy Plant Mini Kit following the manufacturer's instructions (Qiagen, Intl) and genomic DNA was quantified with the Qubit 2.0 fluorometer (Life Technologies, Intl.). The partial sequence of the actin gene (ACT) was amplified using the primers ACT-512F: ATGTGCAAGGCCGGTTTCGC and ACT-783R: TACGAGTCCTTCTGGCCCAT to obtain resolution at the species level3,14. Sequencing of the fragments was done by Macrogen Inc. (Seoul, Korea). Pathogenicity tests were performed using the toothpick technique2 and verified according to Koch's postulates.

After the molecular analysis, the nine different morphological groups were reduced to 3 species as causal agents of the disease. BLAST analysis of 200bp fragments from the isolates with Cladosporium strain reference sequences obtained from the GenBank showed 100% identity to Cladosporium subtilissimum (isolate 53ACT GenBank Accession No. MG680545.1), Cladosporium macrocarpum (isolate 12ACT GenBank Accession No. MG680533.1) and Cladosporium floccosum (culture CPC 17802 GenBank Accession No. MF473823.1). As a result of the pathogenicity tests, the C. subtilissimum isolates produced a 1.5cm lesion on the surface of the fruits with internal necrosis 1.1cm deep (dry tissue that emerges like a plug). C. macrocarpum isolates produced an average lesion of 1.5cm on the surface of the fruit with wet internal necrosis averaging 1.7cm. C. floccosum isolates caused an external average lesion of 1cm surrounded by a brown halo with dark brown internal necrosis extending 1.5cm deep (dry tissue that emerges like a plug).

Cladosporium species are predominant in indoor and outdoor environments4,11,13. C. macrocarpun and C. subtilissimum have been reported in a previous study conducted in rural environments of the High Valley of Río Negro productive region in Northern Patagonia in which eleven species were determined. Pathogenicity tests revealed that C. macrocarpun and C. subtilissimum, among other Cladosporium species, caused disease on pears14. The presence of these and other potentially phytopathogenic species in the air warns about the potential risk of infections by these causal agents during cold storage and/or growing seasons in the field. Emerging diseases can be expected in the context of climate change, such as that which has been occurring in Northern Patagonia (Argentina)6,10. These findings contribute to implementing appropriate preventive measures to reduce losses in pear production due to Cladosporium rot.

GenBank Accession numbers are MK410437-MK410445 (under examination and processing by the GenBank annotation staff).

Conflict of interest

None

Acknowledgments

To María del Valle Leiva, Soledad Ramírez and María de los Ángeles Pérez. This research was financially supported by Universidad Nacional de Río Negro and CONICET.

References
[1]
B. Andersen, E. Krøger, R. Roberts.
Chemical and morphological segregation of Alternaria alternata.
A. gaisen and A. longipes. Mycological Research., 105 (2001), pp. 291-299
[2]
B. Andersen, E. Kroger, R. Roberts.
Chemical and morphological segregation of Alternaria arborescens A. infectoria and A. tenuissima species-groups.
Mycological Research., 106 (2002), pp. 170-182
[3]
K. Bensch, U. Braun, J. Groenewald, P. Crous.
The genus Cladosporium.
Studies in Mycology., 72 (2012), pp. 1-401
[4]
K. Bensch, J. Groenewald, M. Meijer, J. Dijksterhuis, Z. Jurjevi, B. Andersen, J. Houbraken, P. Crous, R. Samson.
Cladosporium species in indoor environments.
Studies in Mycology., 89 (2018), pp. 177-301
[5]
M. Lutz, M. Sosa, A. Colodner.
Effect of pre and postharvest application of fungicides on postharvest decay of Bosc pear caused by Alternaria-Cladosporium complex in North Patagonia, Argentina.
Scientia horticulturae., 225 (2017), pp. 810-817
[6]
Redagraria.com [Internet]. El cambio climático en el Alto Valle; 2006. [Access in: Jan. 2006]. Available from: http://www.redagraria.com/meteorologia/Alto%20Valle%20Clima.html.
[7]
Y. Park, K. Kim, J. Lee, S. Cho, Y. Choi, Y. Kim.
Cladosporium sp. is the major causal agent in the microbial complex associated with the skin sooty dapple disease of the Asian pear in Korea.
The Plant Pathology Journal., 24 (2008), pp. 118-124
[8]
J. Pitt, A. Hocking.
Fungi and Food Spoilage.
3rd edition., Springer, (2009),
[9]
Pscheidt J, Ocamb C, senior editors. 2019. Pacific Northwest Plant Disease Management Handbook. Corvallis, OR: Oregon State University. [On-line] http://pnwhandbooks.org/plantdisease. (Accessed 31 March 2019).
[10]
Inta.gob [Internet]. Boletín Agrometeorológico N° 24 /Mayo: Análisis agrometeorológico Temporada 2013-2014; 2014. Available from: http://inta.gob.ar/sites/default/files/script-tmp-inta_boletin_agrometeorologico_n24_2013-2014.pdf.
[11]
C. Sindt, J. Besancenot, M. Thibaudon.
Airborne Cladosporium fungal spores and climate change in France.
Aerobiologia., 32 (2016), pp. 53-68
[12]
M.C. Sosa.
Desde el campo a la conservación: Nuevos desafíos en el manejo de enfermedades emergentes de los frutales de pepita de la Norpatagonia Argentina.
XV Jornadas Fitosanitarias Argentinas, (2015),
[13]
C. Temperini, M. Franchi, M. Benavides Rozo, M. Greco, A. Pardo, G. Pose.
Diversity and abundance of airborne fungal spores in a rural cold dry desert environment in Argentinean Patagonia.
Science of the Total Environment., 665 (2019), pp. 513-520
[14]
C. Temperini, G. Pardo, G. Pose.
Diversity of airborne Cladosporium species isolated from agricultural environments of northern Argentinean Patagonia: molecular characterization and plant pathogenicity.
Aerobiologia., (2018), pp. 1-13
[15]
M. Wenneker, J. Köhl.
Postharvest decay of apples and pears in the Netherlands.
In Proc.II International Symposium on Discovery and Development of Innovative Strategies for Postharvest Disease Management, 1053 (2014), pp. 107-112

Present address: Universidad Nacional de Quilmes/Laboratorio de Micología y Cultivo de Hongos Comestibles - INTECH (CONICET).

Copyright © 2020. Asociación Argentina de Microbiología
Opciones de artículo
es en pt

¿Es usted profesional sanitario apto para prescribir o dispensar medicamentos?

Are you a health professional able to prescribe or dispense drugs?

Você é um profissional de saúde habilitado a prescrever ou dispensar medicamentos