Regístrese
Buscar en
Revista Mexicana de Trastornos Alimentarios - Mexican Journal of Eating Disorders
Toda la web
Inicio Revista Mexicana de Trastornos Alimentarios - Mexican Journal of Eating Disorder... Binge eating disorder, depression, anxiety and Agouti gen related neuropeptide i...
Información de la revista
Vol. 8. Núm. 2.
Páginas 161-170 (Julio - Diciembre 2017)
Compartir
Compartir
Descargar PDF
Más opciones de artículo
Visitas
1357
Vol. 8. Núm. 2.
Páginas 161-170 (Julio - Diciembre 2017)
ARTÍCULO
DOI: 10.1016/j.rmta.2017.04.004
Open Access
Binge eating disorder, depression, anxiety and Agouti gen related neuropeptide in patients with bariatric surgery
Trastorno por atracón, depresión, ansiedad y gen del neuropéptido relacionado con Agouti en pacientes con cirugía bariátrica
Visitas
1357
Araceli Gómez-Alvaa,
Autor para correspondencia
aracelipsic@gmail.com

Autor para correspondencia.
, Mónica Fernández-Murilloa,b, David Velázquez-Fernándezb, Jeny Flores-Moralesc, Pablo Leónc, Gabriela Elisa Mercado-Celisc,d, Diana Betancourt-Ocampoa, Jimena Funtanet-Martíneza, Esther Kobi-Lomelina, Mary Ann Mosti-Molinab, Miguel F. Herrera-Hernándezb
a Facultad de Psicología, Universidad Anáhuac México-Norte, Huixquilucan, Estado de México, México
b Centro de Nutrición y Obesidad ABC, The American British Cowdray Medical Center, Ciudad de México, México
c Instituto Nacional de Medicina Genómica, Ciudad de México, México
d Laboratorio de Genómica, División de Estudios de Posgrado e Investigación, Facultad de Odontología, Universidad Nacional Autónoma de México, Ciudad de México, México
Información del artículo
Resumen
Texto completo
Bibliografía
Descargar PDF
Estadísticas
Figuras (3)
Mostrar másMostrar menos
Tablas (2)
Tabla 1. Comparación entre los grupos respecto a la sintomatología de depresión y de ansiedad
Tabla 2. Comparación por tipo de obesidad en cuanto a sintomatología depresiva, de ansiedad y trastorno por atracón
Mostrar másMostrar menos
Abstract

The objective of this retrospective study was to analyze the relationship between the symptoms of depression, anxiety and binge eating disorder (BED) with the gene related to the Agouti neuropeptide in patients undergoing bariatric surgery. A cohort of 249 adults (average age=41.1, SD=11.3), 64.1% women and 35.9% men, were included. The assessment of depression, anxiety and BED symptoms was carried out through a semi-structured interview. In addition, the body mass index was calculated, and blood samples were taken for an allelic discrimination analysis. Of the total number of patients 20.2% were diagnosed with BED, finding an association of this disorder with a lower weight loss after bariatric surgery at 6, 12, 18 and 24 months. The measures of depression and anxiety did not differ between patients with BED vs. without BED. Patients with a mutant allele in the gene related to the Agouti neuropeptide were 2.6 times more likely to present BED (95% CI 1.0-6.8, P=0.04). In addition, BED appears to be more frequent in patients with a gene related to the Agouti neuropeptide mutated. When obesity is studied, it is emphasized the need to address both psychological and genetic factors.

Keywords:
Obesity
Binge eating
Human genome
Depression
Anxiety
Resumen

El objetivo de este estudio retroprospectivo fue analizar la relación de la sintomatología de depresión, de ansiedad y el trastorno por atracón (TPA) con el gen del neuropéptido relacionado con Agouti en pacientes sometidos a cirugía bariátrica. Participó una cohorte de 249 adultos (edad media=41.1, DE=11.3), 64.1% mujeres y 35.9% hombres. La evaluación de la sintomatología depresiva, de ansiedad y de TPA se llevó a cabo a través de una entrevista semiestructurada. Además, se calculó el índice de masa corporal y se tomaron muestras de sangre para realizar un análisis de discriminación alélica. Del total de pacientes, un 20.2% fueron diagnosticados con TPA, encontrando una asociación de este trastorno con una menor pérdida de peso posterior a la cirugía bariátrica a los 6, 12, 18 y 24 meses. Las medidas de depresión y de ansiedad no difirieron entre pacientes con TPA vs. sin TPA. Los pacientes con un alelo mutante en el gen del neuropéptido relacionado con Agouti tuvieron un riesgo 2.6 veces mayor de presentar TPA (IC 95% 1.0-6.8; p=0.04). Además, el TPA parece ser más frecuente en pacientes con el gen del neuropéptido relacionado con Agouti mutado. Destaca la necesidad de que en el estudio de la obesidad se aborden tanto los aspectos psicológicos como los genéticos.

Palabras clave:
Obesidad
Atracón
Genoma humano
Depresión
Ansiedad
Texto completo
Introducción

El problema de la obesidad afecta a todo el mundo, considerándosele la epidemia del siglo xxi (Organización Mundial de la Salud, 2014, 2016), y actualmente constituye la sexta causa de disfunción (Dávila-Torres, González-Izquierdo y Barrera-Cruz, 2015). En 2014 más de 1,900 millones de adultos tenían sobrepeso, de los que más de 600 millones tenían obesidad. En lo que respecta a México, resultados de la Encuesta Nacional de Salud y Nutrición indican que más del 70% de la población adulta presenta sobrepeso (Barquera, Campos-Nonato, Hernández-Barrera, Pedroza y Rivera-Dommarco, 2013), cifra mayor que la de cualquier otro país de la Organización para la Cooperación y el Desarrollo Económicos (2014). Desde el año 2000, las tasas de sobrepeso y obesidad han venido aumentando de forma constante tanto en hombres como en mujeres. Así, de acuerdo con las últimas estimaciones, siete de cada 10 adultos y uno de cada tres niños (5 a 19 años) presentan sobrepeso u obesidad (Dávila-Torres et al., 2015; Rivera, Campos-Nonato, Barquera y González, 2013).

La obesidad se define como una acumulación anormal o excesiva de grasa que puede ser perjudicial para la salud (Organización Mundial de la Salud, 2014, 2016). Es una enfermedad sistémica, crónica y de etiología multifactorial que no es exclusiva de los países desarrollados, sino que involucra a todos los grupos de edad, de distintas etnias y de todas las clases sociales. En su origen participan tanto factores genéticos como ambientales que determinan un trastorno metabólico y un fenotipo caracterizado por el exceso de tejido graso (Dávila-Torres et al., 2015; Rivera et al., 2013). Dávila-Torres et al. señalan que el sobrepeso y la obesidad incrementan significativamente el riesgo de padecer enfermedades crónicas no transmisibles, la mortalidad prematura y el costo social de la salud, además de reducir la calidad de vida. En cuanto al aspecto psicológico, la obesidad aumenta el riesgo de padecer depresión, lo que a su vez incrementa el riesgo de desarrollar obesidad. Por eso se recomienda que en todo programa de control de peso se incluyan intervenciones de soporte psicológico individual, grupal y/o psiquiátrico y, en casos específicos, coadyuvar a la identificación de condiciones psicopatológicas (e. g., ansiedad, depresión, conducta bulímica, trastornos de la conducta alimentaria) que puedan ser determinantes en la obesidad (Dávila-Torres et al., 2015; Gempeler, 2005; Centro Nacional de Excelencia Tecnológica en Salud, 2012).

En general, en cuanto a las diferentes modalidades de intervención, la cirugía bariátrica (CB) es la que ha mostrado mejores resultados en el tratamiento de la obesidad mórbida. Ribaric, Buchwald y McGlennon (2014), en un metaanálisis en donde se comparó la eficacia de la CB y del tratamiento médico convencional tanto en la pérdida de peso como en el control de la diabetes mellitus tipo 2 en pacientes con obesidad, concluyen que la CB fue significativamente más efectiva. Buddeberg-Fischer et al. (2006) compararon a pacientes con obesidad mórbida (OM) sometidos a CB vs. un grupo control sin cirugía, e identificaron mayor pérdida de peso en los primeros. En particular, la derivación gastroyeyunal en Y de Roux, o bypass gástrico, es la técnica quirúrgica que ha arrojado mejores resultados tanto en eficiencia en términos de pérdida de peso como en seguridad para estos pacientes, con menor número de cirugías de revisión, conversión o reoperaciones (Colquitt, Clegg, Loveman, Royle y Sidhu, 2005; Gill et al., 2016; Sjöström, 2013).

En términos de salud mental, Bustamante, Williams, Vega y Prieto (2006) plantean que la pérdida de peso posterior a CB puede tener resultados positivos, al incrementar el índice de salud global y mostrar una mejor adaptación social por parte de los pacientes, ayudando además a disminuir la insatisfacción corporal. Azagury y Morton (2016) reportaron que la tasa de defunciones, en un lapso de 30 días tras la derivación gastroyeyunal en Y de Roux, fue de solo 0.07-0.14% en centros acreditados de Estados Unidos. Sin embargo, se ha reportado que 20-30% de los pacientes no alcanzan la pérdida de peso esperada (Brethauer et al., 2014; Cooper, Simmons, Webb, Burns y Kushner, 2015; Puziferr et al., 2014), y 30-50% vuelven a ganar algo del peso perdido (Amianto, Ottone, Abbate y Fassino, 2015; Crowley et al., 2012; Herrera, 2011; Sarwer y Dilks, 2011; Wadden et al., 2011).

Por otro lado, al trastorno por atracón (TPA), dada su alta prevalencia e impacto en la obesidad y la diabetes, también se le considera un problema de salud pública (Berkman et al., 2015). Desde el punto de vista de la salud mental, al TPA formalmente se le reconoce como un trastorno de la conducta alimentaria en la cuarta edición, texto revisado, del Manual diagnóstico y estadístico de los trastornos mentales (American Psychiatric Association, 2000). En cuanto a la prevalencia del TPA, las estimaciones realizadas entre adultos estadounidenses de población general, considerando hombres y mujeres, la han ubicado en 1.54% (Pawaskar et al., 2016); y, por sexo, se ha estimado en un 2% entre varones y 3.5% entre mujeres (Berkman et al., 2015; Hudson, Hiripi, Pope y Kessler, 2007), con una asociación significativa entre el TPA y la OM. Hood, Grupski, Hall, Ivan y Corsica (2013) encontraron, en una muestra de 530 candidatos a CB que completaron la Binge Eating Scale, que un tercio presentaron TPA en un nivel de leve a moderado, y en 9% fue severo.

Como se puede apreciar, la obesidad está en la frontera entre la afección física y la conductual, la cual es una línea de investigación que estudia la genética conductual. La identificación de genes específicos que predisponen a ciertas conductas como el TPA ayudaría a la detección oportuna de estos pacientes, tal y como sucede con algunas adicciones, como el alcoholismo. La detección de estos genes de susceptibilidad o predisposición ha sido muy exitosa para muchas enfermedades, como la colitis ulcerativa crónica inespecífica, así como la misma obesidad. Esto podría ofrecer otra puerta a la comprensión de los vínculos que ligan muchas conductas y enfermedades humanas con la ciencia genómica (Martínez, 2004; Vásquez-Machado y Ulate-Montero, 2010; Wright, 2000).

Los métodos de asociación y ligamento genético son instrumentos muy valiosos para discriminar el componente hereditario de enfermedades de origen multifactorial, como es la obesidad. Múltiples estudios han demostrado que la mutación en el gen del neuropéptido relacionado con Agouti (AGRP) está asociada a fenotipos de obesidad en ratones y humanos. Este gen es crucial en el control hipotalámico del apetito, y su expresión se encuentra aumentada en un grupo neuronal encargado del control del mismo en seres humanos (Fraser, Dhaliwal, Vickers, Krechowec y Breier, 2016; Katsuki et al., 2001; Luquet et al., 2005; Ollmann et al., 1997; Shutter et al., 1997). Este gen se encuentra localizado en el locus 16q22 y codifica para un neuropéptido que induce el apetito, pero que además es antagonista del sistema de melanocortinas. Varios autores han demostrado que mutaciones en este gen inducen obesidad en adultos, incrementando el índice de masa corporal (IMC; Kalnina et al., 2009; King, 2016; Piña, Álvarez, Madrigal y Espinosa, 2011). Además, muchos otros polimorfismos genéticos en el genoma humano han sido asociados a la regulación neuroendocrina del apetito, de los cuales al menos 20 están asociados con algún aspecto de la obesidad. La predisposición genética, sumada a factores ambientales (e. g., mayor disponibilidad de alimentos, sedentarismo) o a algunos factores psicológicos que afectan procesos cognitivos y emocionales (e. g., percepción corporal, compulsión por la comida, niveles altos de ansiedad y/o depresión, baja autoestima), podrían desencadenar condiciones como el TPA y, con ello, una menor pérdida de peso posterior a la CB (Martínez, 2004; Mestas, Gordillo, Arana y Salvador, 2012; Piña et al., 2011).

Existe consenso en cuanto a que el TPA es un tópico que requiere de un mayor estudio (Cuadro y Baile, 2015; Giner, 2011) tanto para precisar sus criterios diagnósticos como para profundizar en la caracterización de sus implicaciones en el ámbito clínico y, por ende, su abordaje específico en las intervenciones dirigidas a los pacientes con OM, o bien a aquellos sometidos a CB, buscando incidir en el mantenimiento de la reducción del peso. Con base en lo anterior, los objetivos de este trabajo fueron: 1) analizar la relación entre la sintomatología depresiva, de ansiedad y el TPA en pacientes con obesidad sometidos a CB, y 2) analizar la relación de dichas variables con el polimorfismo de nucleótido único rs5030980 del gen AGRP en pacientes con obesidad y TPA sometidos a CB.

MétodoDiseño

Fue de tipo observacional, de asociación, comparativo y con seguimiento retroprospectivo de una cohorte de pacientes con obesidad sometidos a CB.

Participantes

Se seleccionó una muestra no probabilística de la cohorte total de pacientes obesos sometidos a CB en el Centro de Nutrición y Obesidad ABC, cohorte que ha sido seguida prospectivamente por un equipo multidisciplinario de especialistas de dicho centro. Todos los pacientes fueron intervenidos entre octubre de 2004 y mayo de 2014. Los criterios de inclusión fueron los siguientes: 1) pacientes de cualquier origen ancestral, de entre 18 y 90 años de edad; 2) pacientes con IMC igual o superior a 35kg/m2 y comorbilidades asociadas, o bien con IMC igual o mayor a 40kg/m2, con o sin comorbilidades asociadas; 3) con indicación para CB, o bien quienes ya hubieran sido sometidos a CB de manera inmediata (en los primeros 2 meses de la cirugía), y 4) tener un seguimiento clínico postoperatorio de al menos un año. Los pacientes fueron excluidos cuando no cumplían con los criterios antes expuestos, no se contara con sus datos clínicos (e. g., IMC), o presentaran alguna endocrinopatía que pudiera ocasionar la obesidad (e. g., síndrome de Prader-Willi).

Es importante aclarar que el IMC registrado corresponde al del momento en el que los pacientes ingresaron al presente estudio, muchos de los cuales ya habían sido operados y solo estaban en seguimiento, por lo que su IMC no necesariamente era igual o mayor a 35kg/m2, el que como ya se señaló es el requerido para canalizar a los pacientes a CB. Por tanto, la muestra para este estudio quedó conformada por un total de 249 pacientes con OM que fueron sometidos a derivación gastroyeyunal en Y de Roux. De estos, 64.1% fueron mujeres y 35.9% fueron hombres, abarcando un rango de edad de entre 22 y 87 años (M=41.06, DE=11.30).

Medidas

Peso corporal. Se registró el IMC, que es un indicador de peso ajustado por talla (kg/m2), el que comúnmente se usa para clasificar a un individuo en términos de su peso corporal. Para la clasificación, se retomaron los criterios siguientes: sobrepeso, IMC>25; obesidad grado 1, IMC>30; obesidad grado 2, IMC>35; obesidad grado 3 (OM), IMC>40; obesidad grado 4 (superobesidad), IMC>50 (Organización Mundial de la Salud, 1998; Lépori, 2006). Específicamente, la pérdida de peso en las mediciones postoperatorias (6, 12, 18 y 24 meses) se estimó con base en 2 indicadores: kilos totales y unidades de IMC.

Psicológicas. Para esta investigación se consultaron los expedientes clínicos de los pacientes, cuyos registros corresponden a la evaluación pre-CB que en su momento fue realizada por el equipo de psicología, quienes fueron entrenados para ese propósito. Esta evaluación fue realizada individualmente, con base en una entrevista semiestructurada diseñada ex professo bajo los criterios diagnósticos del DSM-IV-TR (American Psychiatric Association, 2000). Los 3 aspectos consultados en expediente y analizados fueron:

  • 1.

    Depresión. Esta variable midió la presencia o ausencia de depresión mayor, de acuerdo con el cumplimiento de los criterios diagnósticos del DSM-IV-TR (American Psychiatric Association, 2000).

  • 2.

    Ansiedad. Esta variable midió la presencia o ausencia de trastorno generalizado de ansiedad, de acuerdo con el cumplimiento de los criterios diagnósticos del DSM-IV-TR (American Psychiatric Association, 2000).

  • 3.

    TPA. Esta variable midió la presencia o ausencia del TPA, de acuerdo con el cumplimiento de los criterios diagnósticos del DSM-IV-TR (American Psychiatric Association, 2000).

Cabe mencionar que, para fines de esta investigación, estas 3 variables fueron codificadas como medida general dicotómica (sí/no), pero también numéricamente.

Genéticas. Se examinaron los genotipos para el polimorfismo de nucleótido único rs5030980 del gen AGRP. A través de un análisis de discriminación alélica, por el ensayo de TaqMan® (Life Technologies, Thermo Fisher Scientific, Inc.), se realizó la determinación de los diferentes genotipos para cada uno de los pacientes (genotipo homocigoto silvestre, homocigoto mutante y estado de heterocigoto).

Consideraciones éticas

Este proyecto fue sometido y aprobado por el Comité de Ética del Centro Médico ABC. Además, esta investigación se desprende de una previa sobre la genómica de la obesidad y la pérdida de peso (Velázquez-Fernández et al., 2016). Todos los pacientes incluidos en el presente estudio fueron informados sobre los propósitos y procedimientos que subyacen al estudio, y firmaron un formato de consentimiento informado, autorizando tanto su participación como la inclusión de sus datos en el presente trabajo de investigación.

Procedimiento

Peso corporal. Los profesionales del área de enfermería se encargan de tomar varias medidas de composición corporal, pero para el objetivo de esta investigación solo interesa especificar que fueron tomadas las medidas de talla y peso del paciente, y registradas en el expediente. Por tanto, para este estudio se consultó el peso y el IMC de cada paciente en los cuatro diferentes momentos de seguimiento.

Psicológicos. Los datos retomados corresponden a la evaluación pre-CB realizada por el equipo de psicología. Esta evaluación fue realizada individualmente, utilizando una entrevista semiestructurada diseñada ex profeso, bajo los criterios diagnósticos del DSM-IV-TR (American Psychiatric Association, 2000). Cabe advertir que los cambios en los criterios diagnósticos del TPA que se señalan en el DSM-5 (American Psychiatric Association, 2014; Errandonea, 2012; García, 2014; Vázquez, López, Ocampo y Mancilla-Díaz, 2015), respecto a la frecuencia y el tiempo de presentación de los síntomas, coinciden con lo observado en el ámbito clínico, pero debido a que una de las características de esta investigación es que fue retrospectiva, estos cambios no se incluyeron.

Genéticos. Para el análisis molecular se realizaron extracciones de ácido desoxirribonucleico genómico de linfocitos periféricos con un kit que comercialmente está disponible (Puregen Blood Kit, Qiagen). El método de extracción y purificación se realizó de acuerdo con las recomendaciones del fabricante y el protocolo predeterminado que fue estandarizado previamente. Antes de correr el análisis, el ácido desoxirribonucleico genómico fue analizado mediante espectrofotometría para garantizar su pureza. Para determinar el genotipo, y discriminar entre homocigoto silvestre, heterocigoto y homocigoto mutante para el gen AGRP, el análisis de discriminación alélica se realizó con la técnica de TaqMan®, o ensayo de 5 prima nucleasa, que se encuentra disponible comercialmente. Este análisis permite discriminar los genotipos antes mencionados, mediante la detección de un fluoróforo reportero en el momento de la amplificación en tiempo real. Para ello se utilizaron sondas marcadas con fluorescencia, también comercialmente disponibles para tecnologías TaqMan®, las que detectan el cambio de nucleótido relacionado con este polimorfismo de nucleótido único respecto a la transición de nucleótidos en la secuencia GCAGTTACCTCTGCCAAGGCCTGAG[C/T]CTCCTGCAACAATCCTCTTCTGCC de este gen. Para la detección se utilizó un sistema de PCR en tiempo real (ABI Prism ViiA Real Time PCR System, Applied Biosystems).

Para cada paciente se realizaron dos replicados técnicos que fueron preparados de la misma alícuota de la extracción, cuyo genotipo fue confirmado por el mismo método. No se encontraron discrepancias. Después del ensayo de discriminación alélica se utilizó un programa especial (SDS v. 2.3) para la lectura e interpretación de los resultados, así como para la designación automática del genotipo y alelo. Todo el análisis molecular, así como las extracciones, se realizaron en las instalaciones del Instituto Nacional de Medicina Genómica, a cargo de uno de los autores.

Análisis de datos

El análisis estadístico, así como la representación de los resultados, fueron realizados con el programa IBM® SPSS® Statistics versión 20.0 (IBM Inc., Chicago, IL) y Excel® Microsoft® 2011 para Mac® versión 12.2.6. Antes del análisis de asociación se verificó el control de calidad de los genotipos obtenidos mediante el análisis de distribución y equilibrio de Hardy-Weinberg. Este equilibrio fue evaluado, a su vez, por pruebas de chi-cuadrado con bondad de ajuste. Además, se realizaron análisis uni- y bivariados, de acuerdo con el escalamiento de cada una de las variables analizadas. Cuando se observó cualquier variación de la distribución normal en una variable, se utilizó estadística no paramétrica con medidas de descripción no gaussianas. Se realizó un análisis de varianza cuando se compararon múltiples variables dimensionales (como la pérdida de peso o IMC) en diferentes puntos de corte, sobre todo en el seguimiento. Cualquier valor de p igual o inferior al 5% o 0.05 para un error alfa se consideró como estadísticamente significativo para una prueba de hipótesis de dos colas.

Resultados

Para determinar la distribución de los participantes por categoría de IMC, se realizó un análisis de frecuencias. Los resultados indicaron que 8.9% de los participantes presentaron sobrepeso u obesidad grado 1, 26.4% obesidad grado 2, 51.2%, obesidad mórbida, y 13.4%, superobesidad. No obstante, es importante puntualizar que como ya se señaló este IMC corresponde al del momento en el que los pacientes ingresaron al presente estudio, muchos de los cuales ya habían sido operados y solo estaban en seguimiento, por lo que su IMC no era igual o mayor a 35kg/m2. Posteriormente se analizó la proporción de participantes que presentaban TPA; los hallazgos mostraron que un 20.2% tenía el trastorno. En este mismo sentido, se analizó la relación entre las categorías del IMC y la presencia/ausencia de TPA. Como se observa en la figura 1, los resultados no mostraron una relación estadísticamente significativa (χ2=2.29, p>0.05); sin embargo, fue sustancialmente mayor la proporción de participantes sin TPA con sobrepeso y obesidad grado 1 en comparación con las otras categorías de peso corporal.

Figura 1.

Distribución (%) de los participantes de ambos grupos, con trastorno por atracón (TPA) y sin TPA, de acuerdo con su índice de masa corporal.

(0,11MB).

Después se analizó si los pacientes con TPA tenían mayor o menor pérdida de peso posterior a la CB a los 6, 12, 18 y 24 meses. Como se puede observar en la figura 2, existe una tendencia general a que los pacientes con TPA tengan un mayor IMC, o una menor pérdida de peso post-CB, que los pacientes sin TPA. Al realizar una prueba t de Student pareada y estratificada por TPA, observamos significación estadística al comparar a los grupos (con TPA vs. sin TPA) en cuanto al IMC preoperatorio (107 con TPA vs. 187 sin TPA), a los 6 meses (46 con TPA vs. 161 sin TPA), 12 meses (39 con TPA vs. 131 sin TPA), 18 meses (17 con TPA vs. 48 sin TPA) y 24 meses (9 con TPA vs. 19 sin TPA); todas con p=0.0001. Con el mismo método esta diferencia también resultó significativa en cuanto al IMC a los 6 meses vs. 12, 18 y 24 meses (todas con p=0.0001). Sin embargo, esta diferencia no fue significativa cuando se comparó el IMC a los 12 meses vs. 18 y 24 meses (p>0.17). Posteriormente, cuando se aplicó a los datos del análisis de varianza de Friedman para dos vías (fig. 2), el resultado también fue estadísticamente significativo (p=0.0001). El IMC fue mayor entre los pacientes que presentaban TPA en relación con los que no, tendencia que se reproduce a los 6, 12, 18 y 24 meses de seguimiento post-CB. En otras palabras, se encuentra que los pacientes con TPA no solo tuvieron un mayor IMC pre-CB, sino también menor pérdida de peso post-CB que los pacientes sin TPA.

Figura 2.

Relación entre la presencia/ausencia de trastorno por atracón (TPA) y el índice de masa corporal (IMC) en cada una de las mediciones realizadas: pre-CB y post-CB (seguimientos a 6, 12, 18 y 24 meses). En el eje de las ordenadas se representa el valor de la mediana del IMC, 25-75%, así como el valor mínimo y el máximo, mientras que en el eje de las abscisas se representa la presencia o ausencia del TPA.

(0,17MB).

Para identificar la existencia de diferencias en la sintomatología depresiva y de ansiedad, en función de la presencia/ausencia de TPA, se llevaron a cabo pruebas t de Student para muestras independientes. Los resultados no mostraron diferencias significativas entre los grupos (tabla 1).

Tabla 1.

Comparación entre los grupos respecto a la sintomatología de depresión y de ansiedad

  Sin TPA (n=201)Con TPA (n=48)t  p 
  M  DE  M  DE     
Depresión  3.02  3.19  3.78  3.58  −1.45  0.15 
Ansiedad  1.92  2.02  2.40  2.20  −1.44  0.15 

DE: desviación estándar; M: media; TPA: trastorno por atracón.

Posteriormente, para determinar las diferencias en la sintomatología depresiva y en la de ansiedad, pero ahora por IMC, se llevó a cabo un análisis de t de Student pareada (tabla 2), y también resultó estadísticamente significativa en todos los puntos de seguimiento (p<0.0001). Sin embargo, de manera bivariada, por medio de la prueba t de Student para muestras independientes, ni la sintomatología de depresión ni la de ansiedad mostraron diferir en función del IMC en los diferentes puntos sobre el tiempo (p>0.05).

Tabla 2.

Comparación por tipo de obesidad en cuanto a sintomatología depresiva, de ansiedad y trastorno por atracón

  Sobrepeso y obesidad tipo 1 (n=22)Obesidad tipo 2 (n=64)Obesidad mórbida (n=125)Superobesidad (n=38) 
  M  DE  M  DE  M  DE  M  DE  t 
Depresión  3.09  3.53  3.04  3.42  3.36  3.21  3.00  3.29  0.19 
Ansiedad  2.18  2.21  1.87  2.09  2.14  2.07  1.93  1.98  0.29 
TPA  1.54  1.87  0.59  1.13  0.96  1.65  0.60  1.17  2.70* 

DE: desviación estándar; M: media; TPA: trastorno por atracón.

*

p<0.05.

Dado que se encontró una frecuencia significativamente mayor del alelo mutante para el gen AGRP en los pacientes con TPA vs. sin TPA, se realizó una prueba chi-cuadrado entre las proporciones de pacientes que contenían este alelo (fig. 3). Así, considerando la proporción de pacientes que tienen un alelo silvestre y uno mutante (heterocigoto), se pudo observar que tenían una menor frecuencia de TPA que los pacientes que tenían los dos alelos mutantes (homocigoto mutante). En estos últimos, la frecuencia de TPA era 2.6 (OR) veces mayor (IC 95% 1.0-6.8) que en los pacientes sin el alelo mutante, lo que resultó estadísticamente significativo (p=0.04). Los pacientes con genotipo homocitogo o heterocigotos portadores del alelo menor del rs5030980 del gen AGRP tuvieron 12.18 (OR) veces mayor probabilidad (IC 95% 1.6-91.9) de ingerir grandes cantidades de comida a pesar de no tener hambre que los pacientes homocigotos para el alelo silvestre del mismo polimorfismo.

Figura 3.

Relación entre la frecuencia porcentual de los genotipos para AGRP y la frecuencia de los episodios recurrentes de la conducta de atracón (arriba), y la cantidad de comida ingerida (abajo).

(0,17MB).
Discusión

Los resultados de esta investigación confirman lo encontrado por Gerlach, Loeber y Herpertz (2016), quienes sustentan que el TPA se encuentra con mayor frecuencia en pacientes con OM. En su artículo, que es una revisión sistemática de 68 estudios, cubriendo los últimos 35 años sobre el tema, describen que los pacientes con personalidades depresivas, antisociales, paranoides o esquizoides tienen mayor predisposición a presentar OM. Esto es relevante incluso para la planificación terapéutica, ya que estos mismos autores encontraron que estos pacientes responden menos al tratamiento médico que sus contrapartes sanos. Autores como Wimmelmann, Dela y Mortensen (2014) señalan que variables psicológicas como la personalidad, la función cognitiva, el trastorno psiquiátrico, la conducta alimentaria y el TPA resultaron tener valor predictivo de los resultados de la CB, influyendo no solo en la conducta alimentaria, sino también en la pérdida de peso postoperatoria, asociado además a una peor calidad de vida. En contraste, Calugi et al. (2016) demostraron, en un estudio de 54 casos y controles con OM, que los pacientes con TPA tienen una pérdida de peso similar a los seis meses, y aun después de cinco años de seguimiento. De acuerdo con estos autores, la presencia de TPA no afecta la pérdida de peso en pacientes tratados médicamente.

Se puede apreciar que existe una gran discusión sobre el papel de las variables psicológicas, así como del TPA, y su impacto negativo sobre la pérdida de peso en pacientes con y sin CB, como mencionan diversos autores que recomiendan el tratamiento intensivo y dirigido de estos trastornos antes de la CB, para obtener mejores resultados y considerar el beneficio de la farmacoterapia para los trastornos psicológicos asociados a la obesidad (Berkman et al., 2015; McElroy, Guerdjikova, Mori y Keck, 2016; Mitchell et al., 2015; Utzinger et al., 2016). Los resultados del presente estudio no mostraron diferencias significativas entre los pacientes con y sin TPA, hallazgos que invitan a continuar investigando sobre el tema.

De los resultados de esta investigación, un aspecto a notar fue la mayor frecuencia del alelo mutante para el gen AGRP asociado a una mayor frecuencia de episodios de TPA. Como ya comentamos previamente, este gen codifica para un neuropéptido orexigénico que es además antagonista del sistema de melanocortinas, el cual representa el sistema anorexigénico más importante en la regulación neuroendocrina del apetito (Gantz y Fong, 2003; Hatoum et al., 2012). La mayor frecuencia de polimorfismo mutante de AGRP en pacientes con TPA puede explicarse por la desregulación del apetito, lo que teóricamente aumentaría el apetito en estos pacientes. Por tanto, los hallazgos de este estudio enfatizan el papel relevante de este grupo neuronal en la regulación neuroendocrina del apetito, y muy probablemente de los aspectos psicológicos, como es el caso del TPA. El sistema nervioso central, en particular el hipotálamo, juega un papel muy importante en la regulación del apetito y, por lo tanto, del metabolismo energético, la partición de nutrientes y la regulación del comportamiento alimentario.

Durante mucho tiempo se ha admitido que el sistema fisiológico de regulación del apetito se encontraba en el hipotálamo; sin embargo, se ha señalado que existen otras zonas del cerebro implicadas en la regulación del apetito, en las que intervienen una amplia variedad de neuropéptidos orexigénicos y anorexigénicos (González, 2011). Adicionalmente a esta regulación central, existen otras sustancias que se originan en la periferia, la mayoría constituidas por péptidos hormonales, como la insulina, el péptido similar al glucagón 1 y 2, la leptina, la colecistocinina y la grelina. Estas, a excepción de la grelina, inhiben el apetito, mientras que la glucosa, un producto metabólico, puede aumentar o reducir el apetito en función de sus niveles en sangre. La grelina es un potente estimulante del apetito que se secreta principalmente por algunas células en la mucosa gástrica e insulares (tipo épsilon) pancreáticas (Núñez-Hernández et al., 2014). Por lo que respecta a los péptidos orexigénicos, los más conocidos son el neuropéptido Y y la proteína relacionada con Agouti (AGRP), que es un potente antagonista de los receptores de melanocortina (MCR3 y MCR4), constituyendo un importante factor del proceso metabólico que regula el comportamiento alimentario y el peso corporal. En general, se podría decir que los neuropéptidos anorexigénicos son supresores del apetito (Genetics Home Reference, 2016; King, 2016).

Hasta donde se sabe hay poca evidencia en la literatura del efecto que tiene el gen AGRP en los pacientes obesos intervenidos de CB. Haider et al. (2007) demostraron que la secreción de la proteína AGRP se incrementa después de una banda gástrica. Estos mismos autores demostraron que aquellos pacientes en los que fue evidente el incremento de la proteína AGRP circulante mejoraron su pérdida de peso, además de algunas condiciones metabólicas generales (e. g., la resistencia a la insulina). Estos autores demostraron que cambios similares en otras hormonas, como la obestatina y la proteína fijadora del retinol 4, favorecen una regulación más similar a las condiciones normales de apetito, lo que podría reforzar la pérdida de peso mantenida después de la CB.

En la presente investigación se pudieron observar relaciones significativas entre el TPA y la sintomatología de depresión y de ansiedad. Sintomatologías que pueden llevar al paciente a presentar episodios de sobreingesta. Cuando se analizaron de manera conjunta los aspectos psicológicos y los genéticos (AGRP), fue interesante descubrir que la presencia de un alelo mutante de este gen se relacionó significativamente con una mayor frecuencia de atracón. Además, esto se confirmó biológicamente, a través de una menor pérdida de peso durante todas las mediciones de seguimiento en el grupo con TPA. Por tanto, aquellos pacientes con una predisposición psicológica o genética a perder menos peso después de la CB deben ser detectados, y expuestos a una mayor intervención psicológica y médica.

Sin embargo, este estudio tiene algunas limitaciones, como es la evaluación de aspectos psicopatológicos solo en población con obesidad, cuando es bien sabido que esta tiene una mayor frecuencia de alteraciones psicopatológicas, condición que puede sesgar nuestras conclusiones. De manera similar, la frecuencia de pacientes con mutación en alguno de los alelos de AGRP fue relativamente baja, por lo que el poder estadístico no fue muy alto, lo que dio por resultado un nivel limítrofe al 5%. Por tanto, estos hallazgos requieren ser validados en una cohorte prospectiva de mayor tamaño muestral y/o mayor poder estadístico. Finalmente, se concluye subrayando la importancia de que en futuras investigaciones dirigidas a la comprensión de la obesidad se aborden no solo los aspectos psicológicos, sino también los genéticos, en tanto paradigma en el que convergen la medicina genómica y la medicina individualizada.

Responsabilidades éticasProtección de personas y animales

Los autores declaran que para esta investigación no se han realizado experimentos en seres humanos ni en animales.

Confidencialidad de los datos

Los autores declaran que en este artículo no aparecen datos de pacientes.

Derecho a la privacidad y consentimiento informado

Los autores declaran que en este artículo no aparecen datos de pacientes.

Conflicto de intereses

Los autores manifiestan no tener ningún conflicto de intereses.

Agradecimientos

Cátedra Ethicon Johnson Anáhuac ABC en Obesidad.

Referencias
[American Psychiatric Association, 2000]
American Psychiatric Association.
Diagnostic and statistical manual of mental disorders, fourth edition, text revised: DSM-IV-TR.
American Psychiatric Association, (2000),
[American Psychiatric Association, 2014]
American Psychiatric Association.
Manual diagno??stico y estadístico de los trastornos mentales: DSM-5.
Editorial Médica Panamericana, (2014),
[Amianto et al., 2015]
F. Amianto, L. Ottone, G. Abbate, S. Fassino.
Binge-eating disorder diagnosis and treatment: A recap in front of DSM-5.
BMC Psychiatry, 15 (2015), pp. e-70
[Azagury y Morton, 2016]
D.E. Azagury, J.M. Morton.
Bariatric surgery: Overview of procedures and outcomes.
Endocrinology & Metabolism Clinics of North America, 45 (2016), pp. 647-656
[Barquera et al., 2013]
S. Barquera, I. Campos-Nonato, L. Hernández-Barrera, A. Pedroza, J.A. Rivera-Dommarco.
Prevalencia de obesidad en adultos mexicanos, 2000-2012.
Salud Pública de México, 55 (2013), pp. 151-160
[Berkman et al., 2015]
Berkman, N. D., Brownley, K. A., Peat, C. M., Lohr, K. N., Cullen, K. E., Morgan, L. C., et al. (2015). Management and outcomes of binge-eating disorder. Agency for Healthcare Research and Quality. Report No.: 15(16)-EHC030-EF. Disponible en: https://www.ncbi.nlm.nih.gov/pubmed/26764442
[Brethauer et al., 2014]
S.A. Brethauer, S. Kothari, R. Sudan, B. Williams, W.J. English, M. Brengman, et al.
Systematic review on reoperative bariatric surgery: American Society for Metabolic and Bariatric Surgery Revision Task Force.
Surgery for Obesity and Related Diseases, 10 (2014), pp. 952-972
[Buddeberg-Fischer et al., 2006]
B. Buddeberg-Fischer, R. Klaghofer, L. Krug, C. Buddeberg, M.K. Müller, O. Schoeb, et al.
Physical and psychosocial outcome in morbidly obese patients with and without bariatric surgery: A 4 1/2-year follow-up.
Obesity Surgery, 16 (2006), pp. 321-330
[Bustamante et al., 2006]
F. Bustamante, C. Williams, E. Vega, B. Prieto.
Aspectos psiquiátricos relacionados con la cirugía bariátrica.
Revista Chilena de Cirugía, 58 (2006), pp. 481-485
[Calugi et al., 2016]
S. Calugi, A. Ruocco, M. El Ghoch, C. Andrea, E. Geccherle, F. Sartori, et al.
Residential cognitive-behavioral weight-loss intervention for obesity with and without binge-eating disorder: A prospective case-control study with five-year follow-up.
International Journal of Eating Disorders, 49 (2016), pp. 723-730
[Centro Nacional de Excelencia Tecnológica en Salud, 2012]
Centro Nacional de Excelencia Tecnológica en Salud. (2012). Diagnóstico, tratamiento y prevención del sobrepeso y la obesidad exógena: Evidencias y recomendaciones. Disponible en: DOI: 10.1002/14651858.CD003641.pub2
[Colquitt et al., 2005]
J. Colquitt, A. Clegg, E. Loveman, P. Royle, M.K. Sidhu.
Surgery for morbid obesity.
Cochrane Database Systematic Reviews, 4 (2005),
[Cooper et al., 2015]
T.C. Cooper, E.B. Simmons, K. Webb, J.L. Burns, R.F. Kushner.
Trends in weight regain following roux-en-Y gastric bypass (RYGB) bariatric surgery.
Obesity Surgery, 25 (2015), pp. 1474-1481
[Crowley et al., 2012]
N. Crowley, M. Lepage, R. Goldman, P. O’Neil, J. Borckardt, T.K. Byrne.
The Food Craving Questionnaire-Trait in a bariatric surgery seeking population and ability to predict post-surgery weight loss at six months.
Eating Behaviors, 13 (2012), pp. 366-370
[Cua y Baile, 2015]
E. Cuadro, J.I. Baile.
El trastorno por atracón: Análisis y tratamientos.
Revista Mexicana de Trastornos Alimentarios, 6 (2015), pp. 97-107
[Dávila-Torres et al., 2015]
J. Dávila-Torres, J.J. González-Izquierdo, A. Barrera-Cruz.
Panorama de la obesidad en México.
Revista Médica del Instituto Mexicano del Seguro Social, 53 (2015), pp. 240-249
[Errandonea, 2012]
M.I. Errandonea.
Obesidad y trastornos de alimentación.
Revista Médica Clínica Las Condes, 23 (2012), pp. 165-171
[Fraser et al., 2016]
M. Fraser, C.K. Dhaliwal, M.H. Vickers, S.O. Krechowec, B.H. Breier.
Diet-induced obesity and prenatal undernutrition lead to differential neuroendocrine gene expression in the hypothalamic arcuate nuclei.
Endocrine, 53 (2016), pp. 839-847
[Gantz y Fong, 2003]
I. Gantz, T.M. Fong.
The melanocortin system.
American Journal of Physiology, Endocrinology and Metabolism, 284 (2003), pp. 468-474
[García, 2014]
A. García.
El trastorno por atracón en el DSM-5.
Medicina Psicosomática y Psiquiatría de Enlace, 110 (2014), pp. 70-74
[Gempeler, 2005]
J. Gempeler.
Trastorno por atracones: ¿Entre los trastornos de la conducta alimenticia y la obesidad? Una mirada cognoscitiva comportamental.
Revista Colombiana de Psiquiatría, 34 (2005), pp. 242-250
[Genetics Home Reference, 2016]
Genetics Home Reference (2016). AGRP gene: Agouti related neuropeptide. NIH, U. S. National Library of Medicine [consultado 13 Jun 2016]. Disponible en: https://ghr.nlm.nih.gov/gene/AGRP
[Gerlach et al., 2016]
G. Gerlach, S. Loeber, S. Herpertz.
Personality disorders and obesity: A systematic review.
Obesity Review, 17 (2016), pp. 691-723
[Gill et al., 2016]
R.S. Gill, S.R. Majumdar, C.F. Rueda-Clausen, S. Apte, D.W. Birch, S. Karmali, et al.
Comparative effectiveness and safety of gastric bypass, sleeve gastrectomy and adjustable gastric banding in a population-based bariatric program: Prospective cohort study.
Canadian Journal of Surgery, 59 (2016), pp. 233-241
[Giner, 2011]
Giner, M. (2011). Personalidad y psicopatología en el trastorno por atracón [Tesis doctoral]. Barcelona, España: Universidad Internacional de Catalunya. Disponible en: http://www.tdx.cat/bitstream/handle/10803/48513/TESI_Montse_Giner.pdf;sequence=2
[González, 2011]
E. González.
Genes y obesidad: Una relación de causa-consecuencia.
Endocrinología y Nutrición, 58 (2011), pp. 492-496
[Haider et al., 2007]
D.G. Haider, K. Schindler, G. Prager, A. Bohdjalian, A. Luger, M. Wolzt, et al.
Serum retinol-binding protein 4 is reduced after weight loss in morbidly obese subjects.
Journal of Clinical Endocrinology and Metabolism, 92 (2007), pp. 1168-1171
[Hatoum et al., 2012]
I.J. Hatoum, N. Stylopoulos, A.M. Vanhoose, K.L. Boyd, D.P. Yin, K.L. Ellacott, et al.
Melanocortin-4 receptor signaling is required for weight loss after gastric bypass surgery.
Journal Clinical Endocrinology and Metabolism, 97 (2012), pp. 1023-1031
[Herrera, 2011]
M. Herrera.
Anatomía fisiología y resultados durante el primer año posterior a la cirugía.
Bypass gástrico: ¿Qué hay más allá de la cirugía?, pp. 1-5
[Hood et al., 2013]
M.M. Hood, A.E. Grupski, B.J. Hall, I. Ivan, J. Corsica.
Factor structure and predictive utility of the Binge Eating Scale in bariatric surgery candidates.
Surgery Obesity Related Diseases, 9 (2013), pp. 942-948
[Hudson et al., 2007]
J.I. Hudson, E. Hiripi, H.G. Pope, R.C. Kessler.
The prevalence and correlates of eating disorders in the National Comorbidity Survey replication.
Biological Psychiatry, 61 (2007), pp. 348-358
[Kalnina et al., 2009]
I. Kalnina, I. Kapa, V. Pirags, V. Ignatovica, H.B. Schiöth, J. Klovins.
Association between a rare SNP in the second intron of human Agouti related protein gene and increased BMI.
BMC Medical Genetics, 10 (2009), pp. 63
[Katsuki et al., 2001]
A. Katsuki, Y. Sumida, E.C. Gabazza, S. Murashima, T. Tanaka, M. Furuta, et al.
Plasma levels of agouti-related protein are increased in obese men.
Journal of Clinical Endocrinology and Metabolism, 86 (2001), pp. 1921-1924
[King, 2016]
King, M. W. (2016). Gut-brain interrelationships and control of feeding behavior. Disponible en: http://themedicalbiochemistrypage.org/gut-brain.php
[Lépori, 2006]
Lépori, L. (2006). Obesidad [Miniatlas]. Buenos Aires: CLYNA.
[Luquet et al., 2005]
S. Luquet, C. Gaudel, D. Holst, J. Lopez-Soriano, C. Jehl-Pietri, A. Fredenrich, et al.
Roles of PPAR delta in lipid absorption and metabolism: A new target for the treatment of type 2 diabetes.
Biochimica et Biophysica Acta, 1740 (2005), pp. 313-317
[Martínez, 2004]
Martínez, J. A. (2004). Determinantes genéticos de la obesidad. Ibérica: Actualidad Tecnológica, 472, 137-139.
[McElroy et al., 2016]
S.L. McElroy, A.I. Guerdjikova, N. Mori, P.E. Keck.
Managing comorbid obesity and depression through clinical pharmacotherapies.
Expert Opinion on Pharmacotherapy, 17 (2016), pp. 1599-1610
[Mestas et al., 2012]
L. Mestas, F. Gordillo, J.M. Arana, J. Salvador.
Síntesis y nuevas aportaciones para el estudio de la obesidad.
Revista Mexicana de Trastornos Alimentarios, 3 (2012), pp. 99-105
[Mitchell et al., 2015]
J.E. Mitchell, W.C. King, A. Courcoulas, G. Dakin, K. Elder, S. Engel, et al.
Eating behavior and eating disorders in adults before bariatric surgery.
International Journal Eating Disorders, 48 (2015), pp. 215-222
[Núñez-Hernández et al., 2014]
V.J. Núñez-Hernández, E.A. Vargas-Cerero, J. Sánchez-Madrigal, E. Jaramillo, J. Martínez-Navarro, A. Nava.
Nociones sobre fisiología del apetito: Apetito y hambre.
Residente, 9 (2014), pp. 15-19
[Ollmann et al., 1997]
M.M. Ollmann, B.D. Wilson, Y.K. Yang, J.A. Kerns, Y. Chen, I. Gantz, et al.
Antagonism of central melanocortin receptors in vitro and in vivo by agouti-related protein.
Science, 278 (1997), pp. 135-138
[Organización Mundial de la Salud, 1998]
Organización Mundial de la Salud. (1998). Obesity: Preventing and managing the global epidemic [consultado 15 Abr 2015]. Disponible en: http://apps.who.int/iris/handle/10665/42330?locale=es
[Organización Mundial de la Salud, 2014]
Organización Mundial de la Salud. (2014). Cifras y datos: 10 datos sobre la obesidad [consultado 18 Nov 2016]. Disponible en: http://www.who.int/features/factfiles/obesity/es/
[Organización Mundial de la Salud, 2016]
Organización Mundial de la Salud. (2016). Obesidad y sobrepeso [consultado 18 Abr 2015]. Disponible en: http://www.who.int/mediacentre/factsheets/fs311/es/
[Organización para la Cooperación y el Desarrollo Económicos, 2014]
Organización para la Cooperación y el Desarrollo Económicos. (2014). La obesidad y la economía de la prevención [consultado 13 Jul 2015]. Disponible en: https://www.oecd.org/els/health-systems/46068529.pdf
[Pawaskar et al., 2016]
M. Pawaskar, K. Solo, J. Valant, E. Schmitt, M. Nwankow, B.K. Herman.
Characterization of binge-eating behavior in individuals with binge-eating disorder in an adult population in the United States.
Primary Care Companion CNS Disorders, 18 (2016),
[Piña et al., 2011]
A. Piña, I. Álvarez, E. Madrigal, E. Espinosa.
Revisión de los principales genes involucrados en el desarrollo de la obesidad.
Revista Mexicana de Ciencias Farmacéuticas, 42 (2011), pp. 26-38
[Puziferr et al., 2014]
N. Puziferr, T.B. Roshek, H.G. Mayo, R. Gallagher, S.H. Belle, E.H. Livingston.
Long-term follow-up after bariatric surgery: A systematic review.
Journal of American Medical Association, 312 (2014), pp. 934-942
[Ribaric et al., 2014]
G. Ribaric, J.N. Buchwald, T.W. McGlennon.
Diabetes and weight in comparative studies of bariatric surgery vs conventional medical therapy: A systematic review and meta-analysis.
Obesity Surgery, 24 (2014), pp. 437-455
[Rivera et al., 2013]
J.A. Rivera, I. Campos-Nonato, S. Barquera, T. González.
Epidemiología de la obesidad en México: Magnitud, distribución, tendencias y factores de riesgo.
Obesidad en México: Recomendaciones para una política de Estado, pp. 92-118
[Sarwer y Dilks, 2011]
D.B. Sarwer, R. Dilks.
Overview of the psychological and behavioral aspects of bariatric surgery.
Bariatric Times, 8 (2011), pp. 18-24
[Shutter et al., 1997]
J.R. Shutter, M. Graham, A.C. Kinsey, S. Scully, R. Lüthy, K.L. Stark.
Hypothalamic expression of ART, a novel gene related to agouti, is up-regulated in obese and diabetic mutant mice.
Genes & Development, 11 (1997), pp. 593-602
[Sjöström, 2013]
L. Sjöström.
Review of the key results from the Swedish Obese Subjects (SOS) trial: A prospective controlled intervention study of bariatric surgery.
Journal of Internal Medicine, 273 (2013), pp. 219-234
[Utzinger et al., 2016]
L.M. Utzinger, M.A. Gowey, M. Zeller, T.M. Jenkins, S.G. Engel, D.L. Rofey, et al.
Loss of control eating and eating disorders in adolescents before bariatric surgery.
International Journal of Eating Disorders, 49 (2016), pp. 947-952
[Vásquez-Machado y Ulate-Montero, 2010]
M. Vásquez-Machado, G. Ulate-Montero.
Regulación del peso corporal y del apetito.
Acta Médica Costarricense, 52 (2010), pp. 79-89
[Vázquez et al., 2015]
R. Vázquez, X. López, M.T. Ocampo, J.M. Mancilla-Diaz.
El diagnóstico de los trastornos alimentarios del DSM-IV-TR al DSM-5.
Revista Mexicana de Trastornos Alimentarios, 6 (2015), pp. 108-120
[Velázquez-Fernández et al., 2016]
D. Velázquez-Fernández, G. Mercado-Celis, J. Flores-Morales, D. Clavellina-Gaytán, R. Vidrio, E. Vidrio, et al.
Analysis of gene candidate SNP and ancestral origin associated to obesity and postoperative weight loss in a cohort of obese patients undergoing RYGB.
Obesity Surgery., 27 (2016), pp. 1481-1492
[Wadden et al., 2011]
T.A. Wadden, L.F. Faulconbridge, L.R. Jones-Corneille, D.B. Sarwer, A.N. Fabricatore, J.G. Thomas, et al.
Binge eating disorder and the outcome of bariatric surgery at one year: A prospective, observational study.
Obesity, 19 (2011), pp. 1220-1228
[Wimmelmann et al., 2014]
C.L. Wimmelmann, F. Dela, E.L. Mortensen.
Psychological predictors of mental health and health-related quality of life after bariatric surgery: A review of the recent research.
Obesity Research & Clinical Practice, 8 (2014), pp. 314-324
[Wright, 2000]
W. Wright.
Así nacemos: Genes, conducta, personalidad.
Taurus, (2000),

La revisión por pares es responsabilidad de la Universidad Nacional Autónoma de México.

Copyright © 2017. Universidad Nacional Autónoma de México, Facultad de Estudios Superiores Iztacala
Opciones de artículo
Herramientas
es en pt
Política de cookies Cookies policy Política de cookies
Utilizamos cookies propias y de terceros para mejorar nuestros servicios y mostrarle publicidad relacionada con sus preferencias mediante el análisis de sus hábitos de navegación. Si continua navegando, consideramos que acepta su uso. Puede cambiar la configuración u obtener más información aquí. To improve our services and products, we use "cookies" (own or third parties authorized) to show advertising related to client preferences through the analyses of navigation customer behavior. Continuing navigation will be considered as acceptance of this use. You can change the settings or obtain more information by clicking here. Utilizamos cookies próprios e de terceiros para melhorar nossos serviços e mostrar publicidade relacionada às suas preferências, analisando seus hábitos de navegação. Se continuar a navegar, consideramos que aceita o seu uso. Você pode alterar a configuração ou obter mais informações aqui.