Buscar en
Revista Iberoamericana de Micología
Toda la web
Inicio Revista Iberoamericana de Micología Rapid detection of Cryptococcus gattii sensu lato using gold nanoparticles
Información de la revista
Vol. 34. Núm. 2.
Páginas 122-123 (Abril - Junio 2017)
Compartir
Compartir
Descargar PDF
Más opciones de artículo
Vol. 34. Núm. 2.
Páginas 122-123 (Abril - Junio 2017)
Letter to the Editor
DOI: 10.1016/j.riam.2016.07.001
Acceso a texto completo
Rapid detection of Cryptococcus gattii sensu lato using gold nanoparticles
Detección rápida de Cryptococcus gattii sensu lato mediante nanopartículas de oro
Visitas
...
Fernanda H. Maruyamaa,c, Daphine A.J. de Paulaa,c, Olivia C. Favalessab, Rosane C. Hahnb, Paula G. Cezarinoc, Janaína M.A. Rosaa,c, Luciano Nakazatoa,c,
Autor para correspondencia
lucnak@ufmt.br

Corresponding author.
, Valéria Dutraa,c
a Postgraduate Course in Veterinary Science, Department of Veterinary Science, Federal University of Mato Grosso, Cuiabá, Brazil
b Postgraduate Course in Health Science, Federal University of Mato Grosso, Cuiabá, Brazil
c Veterinary Hospital at UFMT, Cuiabá, Mato Grosso, Brazil
Información del artículo
Texto completo
Bibliografía
Descargar PDF
Estadísticas
Figuras (2)
Tablas (1)
Table 1. Reference strains representing each of the eight major molecular types of the Cryptococcus neoformans/gattii complex, identified using amplified fragment length polymorphism (AFLP) and restriction fragment length polymorphism (RFLP), and non-Cryptococcus strains.
Texto completo
Dear Editor,

Successful treatment of cryptococcosis requires rapid, accurate identification of Cryptococcus neoformans or the Cryptococcus gattii species complex in addition to their discrimination from other pathogenic yeast species. Gold nanoparticles (AuNPs) have enabled improvements in biomedical sciences owing to their versatile properties and capacity for detecting biological molecules at low concentrations; these methods are inexpensive, rapid, and stable.1,2,6–9 We describe the application of AuNPs for detecting C. gattii sensu lato.

Our protocol was approved by the Animal Research Ethics Committees (23108.014032/14-0) and Research Ethics Committees of Hospital Universitário Júlio Muller (888/CEP-HUJM/2010). Twenty-one clinical C. gattii sensu lato isolates and four C. neoformans sensu lato isolates from humans and animals were tested. DNA was extracted using the glass bead method3 and samples representing each of the eight major molecular types of the C. neoformans/gattii species complex were used (Table 1). DNA samples from non-Cryptococcus microorganisms served as controls (Table 1).

Table 1.

Reference strains representing each of the eight major molecular types of the Cryptococcus neoformans/gattii complex, identified using amplified fragment length polymorphism (AFLP) and restriction fragment length polymorphism (RFLP), and non-Cryptococcus strains.

Reference strain/isolate  Genotype 
C. neoformans sensu lato (WM148)  AFLP1/VNI 
C. neoformans sensu lato (WM626)  AFLP1B/VNII 
C. neoformans sensu lato (WM628)  AFLP3/VNIII 
C. neoformans sensu lato (WM629)  AFLP3/VNIV 
C. gattii sensu lato (WM179)  AFLP4/VGI 
C. gattii sensu lato (WM178)  AFLP6/VGII 
C. gattii sensu lato (WM161)  AFLP5/VGIII 
C. gattii sensu lato (WM779)  AFLP7/VGIV 
Aspergillus fumigatus (ATCC 204305)  NAa 
Pichia pastoris (GS115)  NAa 
Conidiobolus lampraugesb (INCQS 40316)  NAa 
Malassezia pachydermatisb  NAa 
Pythium insidiosumc (CBS 101555)  NAa 
a

Not available.

b

Internal transcribed spacer (ITS) sequenced.

c

Stramenopila.

AuNPs were synthesized using the citrate reduction method.4,5 Briefly, 250ml of 1mM gold chloride was boiled and added to 25ml of 38.8mM sodium citrate. For the hybridization test, we used probes based on the superoxide dismutase (SOD1) gene of C. gattii sensu lato (SOD1CGF 5′GATCCTCACGCCATTACG3′ and SOD1CGR 5′GAATGATGCGCTTAGTTGGA3′). First, 50ng of sample DNA was denatured at 95°C for 3min in a mixture containing 1.25M NaCl, 20mM Tris–HCl, and 20pmol oligonucleotides, followed by annealing at 50°C for 2min for hybridization and holding at 4°C. This was followed by addition of 50μl of the prepared AuNPs. Absorption (OD300–OD800) was measured using the BioTek® spectrophotometer (Winooski, VT, USA). The cutoff point was determined using the average absorbance values minus two standard deviations of five control samples without target DNA.

All reference samples were identified as C. gattii sensu lato, and a color change from red to purple indicated a positive reaction. Moreover, five non-Cryptococcus species and four C. neoformans sensu lato isolates were subjected to the AuNP assay to evaluate its specificity. All results were negative with no cross-reaction (100% specificity, Fig. 1).

Figure 1.

AuNPs test for detecting C. gattii based on th sod gene. VNI to VNIV: reference strains of C. neoformans; VGI to VGIV: reference strains of C. gattii. The reddish colour indicates a negative result, the purple one a positive result.

(0,18MB).

In the AuNP test of the reference Cryptococcus strains, there were spectrophotometric signals at the 525 and 655nm absorbance peaks, indicating negative and positive results, respectively (Fig. 2). The average optical density at 525nm for the positive reference samples was 0.28 (confidence interval [CI]=0.27–0.30; SD=0.009), and the average for the negative samples was 0.47 (CI=0.39–0.52; SD=0.05). These results established that a positive sample yields an OD5250.37. Twenty-one (100%) clinical isolates of C. gattii sensu lato showed macroscopic positivity and OD525 values between 0.24 and 0.30, i.e., below the cutoff value for a negative result.

Figure 2.

Graphic representation of the scanning absorbance of the standard positive strains of C. gattii and the standard negative strains of C. neoformans.

(0,38MB).

In summary, AuNPs serve as an alternative tool for developing new methods for clinical diagnosis; our AuNP-based test allowed rapid and specific identification of C. gattii sensu lato isolates. Its main advantages are its simplicity, ease of use, and low cost for set up without the need for sophisticated equipment.

References
[1]
L.N. Brandão, L.C. Pitchenin, F.H. Maruyama, C.S. Chitarra, G.F.R. Silva, C. Klein, et al.
Padronização da técnica de nanopartícula de ouro não modificada (AuNPs) para detecção de Actinobacillus pleuropneumoniae em pulmões de suínos.
Pesq Vet Bras, 34 (2014), pp. 621-625
[2]
P. Chandra, D. Das, A.A. Abdelwahab.
Gold nanoparticles in molecular diagnostics and therapeutics.
Dig J Nanomater Biostruct, 5 (2010), pp. 363-367
[3]
M. Del Poeta, D.L. Toffaletti, T.H. Rude, C.C. Dykstra, J. Heitman, J.R. Perfect.
Topoisomerase I is essential in Cryptococcus neoformans: role in pathobiology and as an antifungal target.
Genetics, 152 (1999), pp. 167-178
[4]
R.G. Freeman, K.C. Grabar, K.J. Allison, R.M. Bright, J.A. Davis, A.P. Guthrie, et al.
Self-assembled metal colloid monolayers: an approach to SERS substrates.
Science, 267 (1995), pp. 1629-1632
[5]
K.C. Grabar, R.G. Freeman, M.B. Hommer, M.J. Natan.
Preparation and characterization of Au colloid monolayers.
Anal Chem, 67 (1995), pp. 735-743
[6]
A.J. Mieszawska, W.J.M. Mulder, Z.A. Fayad, D.P. Cormode.
Multifunctional gold nanoparticles for diagnosis and therapy of disease.
Mol Pharm, 10 (2013), pp. 831-847
[7]
S. Parveen, R. Misra, S.K. Sahoo.
Nanoparticles: a boon to drug delivery, therapeutics, diagnostics and imaging.
Nanomedicine, 8 (2012), pp. 147-166
[8]
P. Valentini, P.P. Pmpa.
Gold nanoparticles for naked-eye DNA detection: smart designs for sensitive assays.
RSC Adv, 3 (2013), pp. 19181-19190
[9]
E.C. Wang, A.Z. Wang.
Nanoparticles and their applications in cell and molecular biology.
Integr Biol (Camb), 6 (2014), pp. 9-26
Copyright © 2016. Asociación Española de Micología
Opciones de artículo
Herramientas
es en pt
Política de cookies Cookies policy Política de cookies
Utilizamos cookies propias y de terceros para mejorar nuestros servicios y mostrarle publicidad relacionada con sus preferencias mediante el análisis de sus hábitos de navegación. Si continua navegando, consideramos que acepta su uso. Puede cambiar la configuración u obtener más información aquí. To improve our services and products, we use "cookies" (own or third parties authorized) to show advertising related to client preferences through the analyses of navigation customer behavior. Continuing navigation will be considered as acceptance of this use. You can change the settings or obtain more information by clicking here. Utilizamos cookies próprios e de terceiros para melhorar nossos serviços e mostrar publicidade relacionada às suas preferências, analisando seus hábitos de navegação. Se continuar a navegar, consideramos que aceita o seu uso. Você pode alterar a configuração ou obter mais informações aqui.