Buscar en
Enfermedades Infecciosas y Microbiología Clínica
Toda la web
Inicio Enfermedades Infecciosas y Microbiología Clínica Validación de la técnica de PCR para la detección de Escherichia coli enteroa...
Información de la revista
Vol. 23. Núm. 8.
Páginas 479-481 (Octubre 2005)
Compartir
Compartir
Descargar PDF
Más opciones de artículo
Vol. 23. Núm. 8.
Páginas 479-481 (Octubre 2005)
Acceso a texto completo
Validación de la técnica de PCR para la detección de Escherichia coli enteroagregativa causante de diarrea del viajero
Validation of a PCR technique for the detection of enteroagreggative Escherichia coli causing traveler's diarrhea
Visitas
...
Joaquim Ruiz-Blázqueza, Martha Vargasb, James P Nataroc, Jordi Vilad, Joaquim Gascón i Brustengaa
a Centro de Salud Internacional.
b Secci??n de Enfermedades Infecciosas.
c Center of Vaccine Development, Departaments of Pediatrics Medicine, and Microbiology and Immunology. University of Maryland. School of Medicine. Baltimore. Estados Unidos.
d Servicio de Microbiolog??a. IDIBAPS. Hospital Cl??nic. Barcelona. Espa??a.
Información del artículo
Resumen
Texto completo
Bibliografía
Descargar PDF
Estadísticas
Tablas (1)
TABLA 1. Comparación de los resultados obtenidos con la técnica de PCR y los de adherencia a células HEp-2
Introducción. La detección de cepas de Escherichia coli enteroagregativas (ECEA) mediante la técnica de referencia (adherencia celular) presenta problemas de implementación metodológica en rutina hospitalaria. Métodos. Se validó la técnica de reacción en cadena de la polimerasa (PCR), en comparación con la de adherencia celular. Resultados. La PCR presentó, respecto a la técnica de adherencia a cultivo celular: sensibilidad de 0,93, especificidad de 1, valor predictivo positivo de 1 y valor predictivo negativo de 0,91. Conclusión. La PCR es alternativa viable para la detección habitual de cepas ECEA.
Palabras clave:
Diarrea
ECEA
HEp-2
Introduction. Detection of enteroaggregative strains of Escherichia coli (EAEC) by the gold standard technique (cellular adherence) is difficult to implement in routine clinical practice. Methods. The gold standard was compared with a PCR method for this purpose. Results. With respect to the cellular adherence technique, PCR performance was as follows: sensitivity 0.93, specificity 1, positive predictive value 1, and negative predictive value 0.91. Conclusion. The PCR method studied is a viable alternative for routine detection of EAEC strains.
Keywords:
Diarrhea
EAEC
HEp-2
Texto completo

Introducción

A lo largo de los últimos años, los países tropicales y subtropicales han devenido un nuevo y atractivo destino turístico, al cual se desplazan millones de viajeros cada año.

La diarrea del viajero es el problema de salud más frecuente entre viajeros que visitan países tropicales. Esta enfermedad está causada por una gran variedad de microorganismos (bacterias, virus, parásitos). El principal agente etiológico de esta enfermedad son las cepas diarreogénicas de Escherichia coli1. Hasta la fecha se han descrito diferentes tipos de E. coli diarreogénicas, siendo la más relevante por su frecuencia la E. coli enterotoxigénica 1. No obstante, la relevancia de otros tipos de E. coli como las E. coli enteroagregativas (ECEA) parece cada vez más evidente. Estas cepas de E. coli se definen por su capacidad para adherirse in vitro a células HEp-2, formando un característico patrón de adherencia agregativo, de donde proviene su nombre 2. Este patrón fenotípico se ha asociado a la presencia de un plásmido de 60-65 MDa (pAA), en el cual también se hallan codificados otros factores de virulencia 3.

Hasta la fecha se han utilizado diferentes metodologías para detectar la presencia de cepas ECEA, así se han detectado mediante hibridación de sondas de ADN 4, técnica que mostró una alta especificidad en la detección de cepas ECEA en comparación con la técnica de adherencia in vitro a células HEp-2, aunque los valores de sensibilidad de la técnica presentan grandes fluctuaciones en diferentes estudios 4-6. Otra técnica utilizada es la de la reacción en cadena de la polimerasa (PCR), con esta técnica se han obtenido resultados equiparables tanto en sensibilidad como especificidad a los obtenidos mediante el uso de sondas de ADN 6.

El objetivo de este estudio fue evaluar la técnica de PCR en comparación con la adherencia a células HEp-2 en cepas ECEA aisladas como causa de diarrea del viajero.

Métodos

Microorganismos

De un estudio caso-control desarrollado con anterioridad en nuestro laboratorio, sobre cepas aisladas de heces de viajeros internacionales 7, se seleccionaron 26 cepas de E. coli (16 del grupo de casos y 10 del de controles). Catorce identificadas en ese estudio como ECEA positivas mediante la técnica de PCR, y 12 ECEA negativas según la misma técnica.

Brevemente, para efectuar la PCR se procedió a hervir una colonia bacteriana en 25 μl de agua estéril, tras someter la muestra a una breve centrifugación (30 s a máxima velocidad) se le añadió la mezcla de reacción, conteniendo TrisHCl (20 mM; pH 8,8); KCl (100 mM); MgCl2 (3 mM); gelatina (0,1%); dNTP (400 μM), 1 μM de cada cebador (cebador 1: CTGGCGAAAGACTGTATCAT; cebador 2: CAATGTATAGAAATCCGCTGTT) y 2,5 U de Taq ADN polimerasa. El programa de PCR utilizado fue: 95 °C, 50 s; 55 °C, 90 s; 72 °C, 120 s. Un total de 30 ciclos. El resultado se visualizó en geles de agarosa al 2% teñidos con bromuro de etidio.

La diarrea del viajero se definió en todos los casos como el proceso diarreico, iniciado como mínimo tras 12 h de estancia en el país visitado y como máximo después de 5 días tras el retorno del viaje, de tres o más episodios diarios de diarrea acuosa con o sin otros síntomas; o la presencia de heces líquidas o pastosas acompañadas por uno de los siguientes síntomas: tenesmo, vómitos, náuseas, fiebre, escalofríos, postración o retortijones.

Para estudiar la adherencia a células HEp-2 se aplicó la metodología previamente descrita 8.

Estadística

Los datos obtenidos se analizaron según el test estadístico de Kappa.

Resultados

Catorce de las 16 (87,5%) cepas del grupo de casos fueron positivas mediante la técnica de cultivo celular, habiendo sido identificadas previamente 13 de estas 14 (92,8%) como ECEA mediante PCR. Por el contrario, sólo una de las cepas procedentes del grupo de controles fue positiva mediante la técnica de cultivo celular, cepa que, de manera previa, había sido identificada como ECEA mediante PCR (tabla 1).

Únicamente una cepa, perteneciente al grupo de casos, fue positiva mediante cultivo celular, no habiendo sido identificada como ECEA mediante PCR.

La sensibilidad de la PCR, respecto a la técnica de cultivo celular fue de 0,93, la especificidad de 1, el valor predictivo positivo de 1 y el valor predictivo negativo de 0,91.

La concordancia entre ambos métodos fue significativa (p < 0,001) con un valor de k del 92,2%.

Discusión

La identificación mediante técnicas rápidas, fiables, económicas y asequibles a los laboratorios hospitalarios es una necesidad para poder implementar de una manera eficiente la detección de determinados patógenos, que por sus características específicas quedan fuera de la capacidad de detección de las baterías de pruebas convencionales.

Diferentes estudios han demostrado la patogenicidad de las cepas ECEA 7, hasta el punto que pasa por ser uno de los patógenos más frecuentemente implicados tanto en la diarrea del viajero como en diarreas infantiles en zonas de baja renta 1,5.

La ECEA se ha incriminado en procesos diarreicos crónicos y con la malnutrición y por ello la detección de estas cepas es importante en los estudios epidemiológicos en zonas donde la malnutrición representa un problema de salud pública 9.

No obstante, en la gran mayoría de laboratorios, la presencia de este patógeno no se investiga de manera habitual, debido a que la técnica considerada de referencia, la adherencia celular a células HEp-2, es de difícil implantación a ese nivel.

En la literatura especializada pueden encontrarse resultados dispares en los estudios de comparación entre la técnica de PCR y la de adherencia celular. Así, por ejemplo, nuestros resultados estarían en la línea de los descritos por Schmidt et al 6, el cual encontró que la técnica de PCR permitía detectar el 88% de las cepas positivas para la prueba de adherencia celular, siendo además todas aquellas cepas detectadas por PCR positivas para esta prueba. Por el contrario, Scaletsky et al 10, mediante PCR, sólo detectan el 57% de las cepas positivas para el test de adherencia.

Entre las posibles razones que pueden explicar estas diferencias está las características de las poblaciones bacterianas locales, en ese sentido, las cepas estudiadas en el presente trabajo tienen la ventaja de representar poblaciones bacterianas sumamente heterogéneas, debido a haber sido aisladas como causa de diarrea del viajero.

En suma, la técnica de PCR es una técnica relativamente económica, de fácil estandarización y ejecución, que permite una cómoda implementación en la rutina hospitalaria. Los elevados niveles de concordancia encontrados en este estudio entre la técnica de PCR y la de adherencia a células HEp-2 demuestran que la detección de este patógeno puede hacerse en el ámbito de la rutina hospitalaria mediante PCR.

Agradecimientos

Joaquim Ruiz-Blázquez está contratado con cargo a fondos de la RICET. Martha Vargas es becaria de la Fundación Carolina. El Centro de Salud Internacional de Barcelona recibe financiación de RICET y RCESP.

Bibliografía
[1]
Svenungsson B, Lagergren A, Ekwall E, Evengard B, Hedlund KO, Karnell A, et al..
Enteropathogens in adult patients with diarrhea and healthy control subjects: a 1-year prospective study in a Swedish clinic for infectious diseases..
Clin Infect Dis, 30 (2000), pp. 770-8
[2]
Nataro JP, Baldini MM, Kaper JB, Black RE, Bravo N, Levine MM..
Detection of an adherence factor of enteropathogenic Escherichia coli with DNA probe..
J Infect Dis, 152 (1985), pp. 560-5
[3]
Czeczulin JR, Whitta.m, TS, Henderson I, Navarro-García F, Nataro JP..
Phylogenetic analysis of enteroaggregative and diffusely adherent Escherichia coli..
Infect Immun, 67 (1999), pp. 2692-9
[4]
Baudry B, Savarino SJ, Vial P, Kaper JB, Levine MM..
A sensitive and specific DNA probe to identify enteroaggregative Escherichia coli, a recently discovered diarrheal pathogen..
J Infect Dis, 161 (1990), pp. 1249-51
[5]
Fang GD, Lima AA, Martins CV, Nataro JP, Guerrant RL..
Etiology and epidemiology of persistent diarrhea in northeastern Brazil: a hospital-based prospective case-control study..
J Pediatr Gastroenterol Nutr, 21 (1995), pp. 137-44
[6]
Schmidt H, Knop C, Franke S, Aleksic S, Heesemenn J, Karch H..
Development of PCR for screening of enteroaggregative Escherichia coli..
J Clin Microbiol, 33 (1995), pp. 701-5
[7]
Gascon J, Vargas M, Quintó L, Corachan M, Jiménez de Anta MT, Vila J..
Enteroaggregative Escherichia coli as a cause of traveler's diarrhea: a case-control study..
J Infect Dis, 177 (1998), pp. 1409-12
[8]
Vial PA, Mathewson JJ, Dupont HL, Guers L, Levine MM..
Comparison of two assay methods for pattern of adherence to HEp-2 cells of Escherichia coli from patients with diarrhea..
J Clin Microbiol, 28 (1990), pp. 882-5
[9]
Lima AA, Guerrant RL..
Persistent diarrhea in children: epidemiology, risk factors, pathophysiology, nutritional impact, and management..
Epidemiol Rev, 14 (1992), pp. 222-42
[10]
Scaletsky IC, Fabbricotti SH, Aranda KR, Morais MB, Fagundes-Neto U..
Comparison of DNA hybridization and PCR assays for detection of putative pathogenic enteroadherent Escherichia coli..
J Clin Microbiol, 40 (2002), pp. 1254-8
Opciones de artículo
Herramientas
es en pt

¿Es usted profesional sanitario apto para prescribir o dispensar medicamentos?

Are you a health professional able to prescribe or dispense drugs?

Você é um profissional de saúde habilitado a prescrever ou dispensar medicamentos