Regístrese
Buscar en
Enfermedades Infecciosas y Microbiología Clínica
Toda la web
Inicio Enfermedades Infecciosas y Microbiología Clínica Serotype, virulence profile, antimicrobial resistance and macrolide-resistance d...
Información de la revista
Vol. 36. Núm. 8.
Páginas 472-477 (Octubre 2018)
Compartir
Compartir
Descargar PDF
Más opciones de artículo
Visitas
851
Vol. 36. Núm. 8.
Páginas 472-477 (Octubre 2018)
Original article
DOI: 10.1016/j.eimc.2017.08.006
Acceso a texto completo
Serotype, virulence profile, antimicrobial resistance and macrolide-resistance determinants in Streptococcus agalactiae isolates in pregnant women and neonates in Catalonia, Spain
Serotipo, perfil de virulencia, resistencia antimicrobiana y determinantes de la resistencia a macrólidos aislados de Streptococcus agalactiae en mujeres embarazadas y neonatos de Cataluña, España
Visitas
851
Yuly Lópeza,
Autor para correspondencia
yuly.lopez@isglobal.org

Corresponding author.
, Elena Parraa, Virginio Cepasa, Isabel Sanfeliúb, Teresa Juncosac, Antonia Andreud, Mariona Xercavinse, Josefa Péreze, Sergi Sanza, Andrea Vergaraa,f, Jordi Boscha,f, Sara Maria Sotoa
a Barcelona Institute for Global Health (ISGlobal) – Hospital Clínic-Universitat de Barcelona, Barcelona, Spain
b Hospital Parc Taulí de Sabadell, Barcelona, Spain
c Hospital Sant Joan de Déu, Barcelona, Spain
d Hospital Universitari Vall d’Hebron, Barcelona, Spain
e CatLab, Hospital Mutua de Terrassa, Barcelona, Spain
f Department of Microbiology, Hospital Clínic-Universitat de Barcelona, Barcelona, Spain
Este artículo ha recibido
851
Visitas
Información del artículo
Resumen
Texto completo
Bibliografía
Descargar PDF
Estadísticas
Tablas (3)
Table 1. Primers used in the study.
Table 2. Distribution of serotype, virulence factor and antimicrobial resistance of 242 GBS studied.
Table 3. Characterization of macrolide–lincosamide resistance.
Mostrar másMostrar menos
Abstract
Introduction

Streptococcus agalactiae, or group B streptococci (GBS), is the main aetiological agent of early neonatal sepsis in developed countries. This microorganism belongs to the gastrointestinal tract microbiota wherefrom it can colonize the vagina and be vertically transmitted to the child either before or at birth, and subsequently cause infection in the newborn. Approximately, 50% of newborns born to women with GBS become colonized, with 1–2% developing early neonatal infection if no preventive intervention is performed. The aim of this study was to characterize and compare serotypes, virulence factors and antimicrobial resistance of GBS isolates collected from pregnant women and newborns in several hospitals in Catalonia.

Methods

242 GBS strains were analyzed including 95 colonizers and 68 pathogenic strains isolated from pregnant women, and 79 strains isolated from neonates with sepsis in order to determine serotype, virulence and antimicrobial resistance.

Results

Serotype distribution was different among the three groups, with serotypes Ia and II being significantly more frequent among colonizing strains (p=0.001 and 0.012, respectively). Virulence factors bca and scpB were significantly more frequent among neonatal strains than pathogenic or colonizing strains (p=0.0001 and 0.002, respectively). Pathogenic strains were significantly more resistant to erythromycin, clindamycin and azithromycin than their non-pathogenic counterparts.

Conclusions

Taking into account that neonatal sepsis represents a significant problem on a global scale, epidemiological surveillance, antimicrobial resistance and GBS virulence at the local level could provide important knowledge about these microorganisms as well as help to improve treatment and prevent invasive infection caused by this microorganism.

Keywords:
Virulence
Serotypes
Antimicrobial resistance
Streptococcus agalactiae
Resumen
Introducción

Streptococcus agalactiae o estreptococos del grupo B (SGB) es el principal agente etiológico de la sepsis neonatal temprana en los países desarrollados. Este microorganismo pertenece a la microbiota del tracto gastrointestinal desde donde puede colonizar la vagina y ser transmitido verticalmente al niño antes o al nacer y posteriormente causar infección en el recién nacido. Aproximadamente el 50% de los recién nacidos de mujeres embarazadas que albergan SGB se colonizan, con 1-2% desarrollando infección neonatal temprana si no se realiza intervención preventiva. El objetivo de este estudio fue caracterizar y comparar serotipos, factores de virulencia y la resistencia a los antimicrobianos de aislamientos de SGB de mujeres embarazadas y neonatos procedentes de varios hospitales de Cataluña.

Métodos

Se analizaron 242 cepas de SGB incluyendo 95 colonizadoras y 68 cepas patógenas aisladas de mujeres embarazadas y 79 cepas aisladas de neonatos con sepsis para determinar serotipo, virulencia y resistencia antimicrobiana.

Resultados

La distribución de los serotipos fue diferente entre los 3 grupos, siendo los serotipos Ia y II significativamente más frecuentes entre las cepas colonizadoras (p=0,001 y 0,012, respectivamente). Los factores de virulencia bca y scpB fueron significativamente más frecuentes entre las cepas neonatales que entre las patógenas o colonizadoras (p=0,0001 y 0,002, respectivamente). Las cepas patógenas fueron significativamente más resistentes a eritromicina, clindamicina y azitromicina que las no patógenas.

Conclusiones

Teniendo en cuenta que la sepsis neonatal es un problema importante a nivel mundial, la vigilancia de la epidemiología, la resistencia a los antimicrobianos y la virulencia del SGB a nivel local podría proporcionar un gran conocimiento de estos microorganismos y ayudar a mejorar el tratamiento y la prevención de la infección invasiva causada por este microorganismo.

Palabras clave:
Virulencia
Serotipos
Resistencia antimicrobiana
Streptococcus agalactiae
Texto completo
Introduction

Streptococcus agalactiae (group B streptococcus [GBS]) is an opportunistic pathogen that colonizes the gastrointestinal and genitourinary tract of healthy people and is responsible for severe diseases in susceptible hosts.1 Moreover, this specie is a leading cause of invasive infection in newborns, causing early neonatal sepsis in developed countries. In Spain, it has been reported that 10–18.5% of pregnant women are colonized by GBS.2

Colonization of the vagina by GBS in pregnant women is of great importance because it increases the risk of infection, due to it can be vertically transmitted to the child before or at birth, causing infection in the newborn. Infection by GBS may arise from a prematurely ruptured amniotic membrane which becomes infected or from infected amniotic fluid (chorioamnionitis) or preterm delivery in a mother colonized by these bacteria, presenting a much higher risk of infecting the offspring due to immaturity of the immune system.3

Approximately, 50% of infants from GBS-colonized women become colonized, with 1–2% of these newborns developing early or late neonatal infection if no preventive intervention is performed.4 To avoid this enhanced risk of vertical transmission, the Center of Disease Control (CDC-1996) recommended the screening of all pregnant women at 35–37 weeks of gestation to determine possible GBS colonization.5 Penicillin and ampicillin are the antibiotics of choice for treatment or intrapartum prophylaxis of GBS, followed by first-generation cephalosporins. In the case of patients allergic to β-lactams, clindamycin, erythromycin and vancomycin are the antimicrobials of choice.6,7

When implemented, the use of these prophylactic measures results in a decrease in the incidence of infection by GBS.8 In Spain, an example of the success of these prophylactic measures was demonstrated in a study carried out in 10 hospitals in Barcelona (Spain). It was found that the incidence of GBS as a cause of neonatal sepsis was reduced from 1.92/1000 newborns in 1994 to 0.26/1000 newborns in 2001 (p<0.001).2

Ten GBS serotypes have been classified (Ia, Ib and II–IX), according to recognized capsular polysaccharides that are considered to be a major virulence factor in invasive disease caused by this microorganism.10 Serotypes Ia, Ib, III and V are the most frequently involved in invasive infection.11 Additionally, GBS can develop different pathogenic mechanisms that allow colonization and invasion in different niches within the host being able to avoid and suppress the host immune response.

The aim of this study was to characterize and compare the serotype, virulence factors and antimicrobial resistance of GBS isolates from pregnant women and newborns from several hospitals in Catalonia.

Materials and methodsClinical sample and bacterial isolates

Two hundred forty-two S. agalactiae isolates were collected from 242 patients from five Catalan hospitals (Hospital Clínic, Vall d’Hebron, San Joan de Déu, Parc Taulí and CatLab) from 2010 to 2016. Among these isolates, 95 were obtained from vaginal, rectal–vaginal and endocervical swabs from asymptomatic pregnant women at 35–37 weeks of gestation and categorized as colonizing; 68 were obtained from urine, blood, amniotic fluid, and endometrial and placental samples from symptomatic women and categorized as pathogenic isolates; and 79 isolates were isolated from blood, cerebrospinal and amniotic fluid samples of newborns with neonatal sepsis. Samples arriving to the different laboratories of Microbiology were cultured in Granada agar and selective Todd-Hewwitt broth specific for GBS isolation. Suspected colonies were confirmed by MALDI-TOF.

Serotyping

Determination of the capsular type or serotype was carried out by a multiplex-PCR using a set of primers described previously.4

Virulence profile

Different virulence determinants, including bac (encoding alpha subunit of the C protein), bca (encoding beta subunit of the C protein), cyl(E) (encoding cytolysin–hemolysin), rib (Alp family protein Rib), hyl(B) (encoding hyaluronidase protein), pep(B) (encoding oligopeptidase protein), scp(B) (encoding an invasin), fbs(B) (encoding fibrinogen-binding protein mediating invasivity), spb(1) (encoding a protein involved in invasivity and adherence), and bib(A) (encoding an adhesin) were investigated by PCR using specific primers (Table 1).

Table 1.

Primers used in the study.

Gene  Primers (5′-3′)  Size (bp)  Annealing (°C) 
Virulence genes
bac  GCAGTTCATATTGGAAGG/  830  52 
  AATTTCTTGATCCAGACCAGC     
bca  TAACAGTTATGATACTTCACAGAC/  535  50 
  ACGACTTTCTTCCGTCCACTTAGG     
cyl(E)  TGACATTTACAAGTGACGAAG/  300  50 
  TTGCCAGGAGGAGAATAGGA     
rib  CAGATGCCGATAAGA/  237  50 
  TACGCGGATCGACAA     
pep  ATCTAGCGATAGGACGGG/  417  50 
  CGTTCAGTAAAAGCACGA     
hyl(B)  CCGTTATCAGTTACAGGTC/  714/2031  50 
  GTCGATGTAAGAACCGTCAGC     
scp(B)  ACAATGGAAGGCTCTACTGTTC/  255  55 
  ACCTGGTGTTTGACCTGAACTA     
fbs(B)  GCGATTCTATCGCTAGCAGTAAC/  1800/2000  55 
  CGGCTGTTGGACAGAAGTTT     
spb(1)  GCTGAGACAGGGACAATTAC/  250  54 
  GTTGAAGGCAACTCAGTACC     
bib(A)  AATCGAAAACAACGTTGGAAAG/  200  52 
  AAACCAGGCTTCATCAGTCATT     
erm(B)  ATGAACAAAAATATAAAATATTCTCAAAAC  679  55 
  ATTTCCTCCCGTTAAATAATAGATAAC     
erm(C)  ATGAACGAGAAAAATATAAAACACAGTCAA  673  55 
  ACTTATTAAATAATTTATAGCTATTGAAAA     
erm(A)  ATGAAACAGAAAAACCCGAAAAATACG  673  55 
  ATTGAAATAATTTGTAACTATTGAAAACAG     
mef(A/E)  AGTATCATTAATCACTAGTGC  348  47.5 
  TTCTTCTGGTACTAAAAGTGG     
Antimicrobial susceptibility testing and macrolide resistance phenotype

The minimal inhibitory concentrations (MICs) were determined using the E-test method according to the protocols established by CLSI.12 The antibiotics tested were: erythromycin, clindamycin, azythromycin, ampicillin, penicillin G and vancomycin. The MLSB resistance phenotype (macrolide–lincosamide–streptogramin B) of the isolates was determined by the double disc diffusion test as described previously.12 The strain Streptococcus pneumoniae ATCC 49619 was used as the quality control.

PCR determination of the macrolide resistance phenotype

The presence of the erm(B), erm(C), erm(A) (Subclass erm(TR)) and mef(A/E) genes was determined by PCR amplification using the primers described in Table 1. The PCR products were visualized by electrophoresis on 1% agarose gels and sent for sequencing to Beckman Coulter Genomics (United Kingdom).

Statistical analysis

Data related to serotypes, virulence and antimicrobial susceptibility of the three study groups were analyzed using contingency tables and Chi-square (χ2) tests. A p value <0.05 was considered statistically significant. The analyses were carried out with the StataCorp. 2015. Stata Statistical Software: Release 14. College Station, TX: StataCorp LP. Correlations of all variables have been determining by the Pearson's correlation coefficient.

Results

Two hundred forty-two GBS isolates were included in the study. The isolates were divided into three groups: colonizers 95/242 (39.3%) (collected from asymptomatic pregnant women), pathogenic 68/242 (28.1%) (collected from symptomatic pregnant women), and neonatal 79/242 (32.6%) (collected from infected neonates).

Serotype III was the most prevalent (33.9%) followed by serotypes II, Ia, V, IV, Ib, and VII (22.7%, 14.9%, 10.7%, 8.7%, 8.3% and 0.8% of isolates, respectively). However, serotypes VI, VIII, IX and X were not detected (Table 2). Among the colonizing isolates, the most frequent serotypes found were serotype II (31.6%), III (26.3%) and Ia (17.9%), while serotypes III, II and IV (38.2%, 22.1% and 13.2%, respectively) were the most prevalent among the pathogenic isolates. In the case of the neonatal isolates, serotypes III, Ia and II (39.2%, 22.8% and 12.7%, respectively) were the most frequently found. Serotype Ia was significantly more frequent among colonizing and neonatal isolates than among pathogenic isolates (p=0.001). On the other hand, serotype II was significantly more frequent among colonizing isolates (p=0.012).

Table 2.

Distribution of serotype, virulence factor and antimicrobial resistance of 242 GBS studied.

Feature studied  Total (n=242)  Colonizing (n=95)  Pathogenic (n=68)  Neonates (n=79)  p-value 
Serotype
Ia  36 (14.9%)  17 (17.9%)  1 (1.5%)  18 (22.8%)  0.001* 
Ib  20 (8.3%)  4 (4.2%)  7 (10.3%)  9 (11.4%)  NS 
II  55 (22.7%)  30 (31.6%)  15 (22.1%)  10 (12.7%)  0.012* 
III  82 (33.9%)  25 (26.3%)  26 (38.2%)  31 (39.2%)  NS 
IV  21 (8.7%)  10 (10.5)  9 (13.2%)  2 (2.5%)  NS 
26 (10.7%)  9 (9.5%)  8 (11.8%)  9 (11.4%)  NS 
VII  2 (0.8%)  2 (2.9%)  NS 
VI  NS 
VIII  NS 
IX  NS 
NS 
Virulence factor
bac  45 (18.6%)  16 (16.9%)  16 (23.5%)  13 (16.5%)  NS 
bca  105 (43.4%)  20 (21.1%)  31 (45.6%)  54 (68.3%)  0.0001* 
cylE  219 (90.5%)  87 (91.6%)  65 (95.6%)  67 (84.8%)  NS 
rib  150 (62.1%)  61 (64.2%)  49 (72.1%)  40 (50.6%)  NS 
pep  21 (8.7%)  21 (26.6%)  0.0001* 
hylB  15 (6.2%)  2 (2.1%)  6 (8.8%)  7 (8.9%)  NS 
scpB  183 (75.6%)  61 (64.2%)  53 (77.9%)  69 (87.3%)  0.002* 
fbsB  80 (33.1%)  37 (39.1%)  27 (39.7%)  16 (20.2%)  0.013* 
spb1  10 (4.1%)  6 (63%)  3 (4.4%)  1 (1.3%)  NS 
bibA  14 (5.8%)  14 (17.7%)  0.0001* 
Antimicrobial resistance
Azithromycin  52 (21.5%)  13 (13.7%)  24 (35.3%)  15 (19%)  0.002* 
Erythromycin  50 (20.7%)  13 (13.7%)  24 (35.3%)  13 (16.5%)  0.002* 
Clindamycin  42 (17.4%)  8 (8.4%)  21 (30.9%)  13 (16.5%)  0.001* 

NS, not significant.

*

Statistically significant.

Regarding the presence of virulence factors, cyl(E) (90.5%), followed by scp(B) (75.6%), rib (62.1%) and bca (43.4%) (Table 2) were the most frequently found among the isolates. The virulence factors pep and bib(A) were only found among the neonatal isolates (26.6% and 17.7%, respectively). On the other hand, the bca and scp(B) genes were significantly more frequent among neonatal isolates (68.3% and 87.3%, p=0.0001 and 0.002, respectively) and the fbs(B) gene was more frequently found among colonizing (39.1%) and pathogenic isolates (39.7%) than among neonatal isolates (20.2%) (p=0.01).

Significant relationships were observed between the presence of several virulence determinants and serotypes. The bac gene was significantly more frequent among serotype Ib (p=0.0002), rib gene among serotype III (p=0.0001), spb(1) gene among serotype II (p=0.0001), and the bib(A) gene was significantly more frequent among serotype V (p=0.049).

All the isolates of this study were susceptible to penicillin, ampicillin and vancomycin. However, 21.5% were resistant to azithromycin (MIC >2μg/mL), 20.7% to erythromycin (MIC >1μg/mL), and 17.6% to clindamycin (MIC >1μg/mL). The erythromycin, azithromycin and clindamycin resistant isolates were significantly more frequent among the pathogenic than among the colonizing and neonatal isolates (p=0.002, 0.002 and 0.001, respectively) (Table 2).

Different MLSB phenotypes were observed among the isolates; 17.8% of strains showed constitutive resistance to clindamycin (cMLSB), 3.3% showed inducible resistance (iMLSB) and 0.3% presented the M phenotype. Among the resistant isolates, the most prevalent gene found was the erm(B) gene (40/52, 77%). 12/52 (23%) unrelated isolates showed the combination of genes of erm(A)–erm(B)–mef(A/E); 5/52 (9.7%) isolates presented the erm(A)–erm(C) genes; and 2/52 (3.8%) isolates presented only the mef(A/E) gene (Table 3).

Table 3.

Characterization of macrolide–lincosamide resistance.

Resistance profile  Colinizing (No=95)Pathogenic (No=68)Neonates (No=79)
  No. (%)  Phenotype  Resistance genes  No. (%)  Phenotype  Resistance genes  No. (%)  Phenotype  Resistance genes 
ERI-CLIN-AZTR  8 (8.4)  MLSBc (8)  erm(B) (8)  18 (26.5)  MLSBc (18)  erm(A)+erm(C) (2)  11 (13.9)  MLSBc (11)  erm(A)+erm(B)+mef(A/E) (8) 
            erm(B) (16)      erm(B) (3) 
ERI-AZTR  5 (5.3)  M (5)  erm(A)+erm(C) (1)  6 (8.8)  M (3)  erm(A)+erm(C) (2)  –  – 
      erm(TR) (1)    MLSBc (3)  erm(B) (3)       
      mef(A/E) (1)      mef(A/E) (1)       
CLIN-AZTR  –  –  –  –  2 (2.5)  MLSBc (2)  erm(A)+erm(B)+mef(A/E) (1) 
                  erm(B) (1) 
AZTR  –  –  –  –  2 (2.5)  MLSBi (2)  erm(A)+erm(B)+mef(A/E) (2) 

ERI, erythromycin; CLIN, clindamycin; AZTR, azithromycin.

No, number of isolates.

Correlation between serotypes, presence/absence of virulence factors and resistance to antibiotics was analyzed. No relationship was observed with antimicrobial resistance. Among colonizing isolates, the presence of bca gene was strongly associated with the presence of bac gene (Pearson's coefficient=0.80).

Discussion

S. agalactiae or group B Streptococcus (GBS) remains one of the most important etiological causes of neonatal sepsis. However, the real burden of GBS infection in newborns is likely underestimated because some cases are not adequately diagnosed, especially in developing countries.13

The present study included 242 GBS isolates collected from five hospitals in Barcelona. Among the GBS isolates studied, four serotypes (III, II, Ia and V) were the most frequent in this study, being serotype II significantly more prevalent among colonizing isolates and serotype Ia among colonizing and neonatal isolates. Our results are somewhat similar to those from other countries in which serotype III was the most frequently found among the GBS strains studied.14,15 Another recent report showed that serotype V was the most frequent in France (44.1%) followed by serotype III.16 In this sense, studies on the distribution of the GBS serotype have shown that GBS varies both geographically and over time, being serotypes Ia, III, and V more frequently involved in neonatal invasive disease, adult infections and maternal carriage.17,18

GBS presented several virulence genes that allow these microorganisms to cause infection and even to cross intact membranes and arrive to the fetus. Recent studies have been focused on analyzing the surface gene profile, but in the present work, other virulence genes such as toxins and invasins were also studied. The most frequent virulence factors found in our study were cyl(E), scp(B), rib and bca most of them related to invasion of epithelial cells.19 These results are in correlation with previous studies carried out in other geographical areas.7,20,21 In the present work, the bca (related to invasion and antophagocytosis) and scp(B) (related to invasion) genes were most prevalent among neonatal isolates, probably favoring the colonization and invasion of neonatal mucosa and blood/brain barrier.21,22 In contrast to our findings, Dutra et al.7 found the bca gene more prevalent among colonizing strains and the scp(B) gene in the 100% of the strains. The virulence factor rib related to invasiveness was more prevalent among serotype III that is associated with invasive infection and, in our study, in agreement with their higher presence in pathogenic isolates. One isolate belonging to serotype III and presenting the spb(1) and rib virulence genes formed part of the ST17 associated with neonatal invasive infections.23

In the present study, we observed a significant percentage of isolates resistant to second choice antibiotics, such as azithromycin, erythromycin and/or clindamycin. Remarkably, we found that the percentage of isolates resistant to these antibiotics was significantly higher among pathogenic than colonizing and neonatal isolates suggesting that, in contrast with other bacteria such Escherichia coli, pathogenic GBS strains are more prone to acquire antimicrobial resistance.24

Moreover, the rates of resistance to macrolides and clindamycin have also been on the rise worldwide. Domelier et al.25 and Campelo et al.9 reported 19% of resistance to erythromycin among GBS strains causing materno-fetal and neonatal disease in France and Las Palmas (Spain), respectively. On the other hand, a study carried out in Switzerland reported 30% of erythromycin resistance and 28% of clindamycin resistance,26 with a significant increase in the number of multidrug-resistant strains. However, other studies have found lower rates of isolates resistant to macrolides among pathogenic strains, being lower or equal of 4%.7,27 These differences could be due to the selective pressure caused by the antimicrobial treatments that these pregnant women could be received during gestation.

Interestingly, the resistance to macrolides and lincosamides in GBS in our study was associated with the presence of the erm(B) gene, being consistent with epidemiological studies about invasive GBS isolates collected from neonates in China and South Korea. On the other hand, the coexistence of several resistant genes such as erm(A), erm(B) and mef(A/E) (12 isolates) is remarkable in our work. These results differ from those published by other authors, who described combinations of these genes, the most common being the erm(A)/erm(B) and erm(A)/mef(A/E) genes.15,16,28

In contrast with other studies that found a significant relationship between erythromycin resistance and serotype III,29–31 this association was not present among our isolates.

In conclusion, although penicillin G and ampicillin continue to be a good treatment for GBS infections, a significant increase in the percentage of isolates resistant to macrolides and lincosamines has been observed. The fact that this increase was observed mainly among GBS causing symptomatic disease implies a serious problem for treating this type of infections. Surveillance of the epidemiology, antimicrobial resistance and virulence of GBS could provide great knowledge about these microorganisms and help to improve the treatment of infections caused by this opportunistic pathogen.

Compliance with ethical standards

The protocols included in the manuscript are in compliance with the ethical standards.

Ethical approval

The project related to this manuscript was approved by the Ethical Committee of the Hospital Clinic of Barcelona (CEIC). Resolution/expedient 2013/8488.

Informed consent

Bacterial samples were collected from the laboratories of the different hospitals. These bacterial samples were isolated from the routine samples collected for the screening under being informed by the obstetricians.

Financial support

This material is based upon work supported by Grants PI13/00127 integrated in the Plan Nacional de I+D+I and cofunding by the “ISCIII Subdirección General de Evaluación” and the “Fondo Europeo de Desarrollo Regional (FEDER)”.

Conflict of interest

The authors declare that no conflict of interest exist.

Acknowledgments

The authors sincerely thank all the lab members who took part in this study. We are grateful to the staff of all the participating hospitals of Catalonia (Spain) for their assistance and collaboration with the isolate collections. ISGlobal is a member of the CERCA Programme, Generalitat de Catalunya.

References
[1]
E.S. Otaguiri, A.E.B. Morguette, E.R. Tavares, P.M.C. dos Santos, A.T. Morey, J.D. Cardoso, et al.
Commensal Streptococcus agalactiae isolated from patients seen at University Hospital of Londrina, Paraná, Brazil: capsular types, genotyping, antimicrobial susceptibility and virulence determinants.
BMC Microbiol, 13 (2013), pp. 297
[2]
A. Andreu, I. Sanfeliu, L. Viñas, M. Barranco, J. Bosch, E. Dopico, et al.
Decreasing incidence of perinatal group B streptococcal disease (Barcelona 1994–2002). Relation with hospital prevention policies.
Enferm Infect Microbiol Clin, 21 (2003), pp. 174-179
[3]
J. Raymond, E. Lopez, S. Bonacorsi, C. Poyart, G. Moriette, P.H. Jarreau, et al.
Evidence for transmission of Escherichia coli from mother to child in late-onset neonatal infection.
Pediatr Infect Dis J, 17 (2008), pp. 186-188
[4]
C. Poyart, A. Tazi, H. Réglier-Poupet, A. Billoët, N. Tavares, J. Raymond, et al.
Multiplex PCR assay for rapid and accurate capsular typing of group B streptococci.
J Clin Microbiol, 45 (2007), pp. 1985-1988
[5]
Centers for Disease Control and Prevention (CDC).
Hospital-based policies for prevention perinatal Group B streptococcal disease United States, 1999.
MMWR Morb Mortal Wkly Rep, 49 (2000), pp. 936-940
[6]
H. Bergseng, L. Bevanger, M. Rygg, K. Bergh.
Real-time PCR targeting the sip gene for detection of group B Streptococcus colonization in pregnant women at delivery.
J Med Microbiol, 56 (2007), pp. 223-228
[7]
V.G. Dutra, V.M.N. Alves, A.N. Olendzki, C.A. Dias, A.F. de Bastos, G.O. Santos, et al.
Streptococcus agalactiae in Brazil: serotype distribution, virulence determinants and antimicrobial susceptibility.
BMC Infect Dis, 14 (2014), pp. 323
[8]
S.J. Schrag, K.E. Arnold, J.C. Mohle-Boetani, R. Lynfield, E.R. Zell, K. Stefonek, et al.
Prenatal screening for infectious diseases and opportunities for prevention.
Obstet Gynecol, 102 (2003), pp. 753-760
[9]
F.A. Campelo, A.C. Pedrosa, I.Á. Antúnez, B.L. Capuz.
Fenotipos y mecanismos de resistencia a macrólidos y lincosamidas en aislados de Streptococcus agalactiae con significación clínica en un período de ocho años (2002–2010).
Rev Esp Quimioter, 25 (2012), pp. 42-46
[10]
C.E. Rubens, M.R. Wessels, L.M. Heggen, D.L. Kasper.
Transposon mutagenesis of type III group B Streptococcus: correlation of capsule expression with virulence.
Proc Natl Acad Sci U S A, 84 (1987), pp. 7208-7212
[11]
K. Fluegge, S. Supper, A. Siedler, R. Berner.
Serotype distribution of invasive group B streptococcal isolates in infants: results from a nationwide active laboratory surveillance study over 2 years in Germany.
Clin Infect Dis, 40 (2005), pp. 760-763
[12]
Clinical and Laboratory Standards Institute (CLSI).
Performance standards for antimicrobial susceptibility testing; 24th informational supplement, M100-S24.
(2014),
[13]
E.R. Martins, A. Andreu, P. Correia, T. Juncosa, J. Bosch, M. Ramirez, et al.
Group B streptococci causing neonatal infections in Barcelona are a stable clonal population: 18-year surveillance.
J Clin Microbiol, 49 (2011), pp. 2911-2918
[14]
F.Y. Lin, P.H. Azimi, L.E. Weisman, J.B. Philips, J. Regan, P. Clark, et al.
Antibiotic susceptibility profiles for group B streptococci isolated from neonates, 1995–1998.
Clin Infect Dis, 31 (2000), pp. 76-79
[15]
P. Wang, J.J. Tong, X.H. Ma, F.L. Song, L. Fan, C.M. Guo, et al.
Serotypes, antibiotic susceptibilities, and multi-locus sequence type profiles of Streptococcus agalactiae isolates circulating in Beijing, China.
PLOS ONE, 10 (2015), pp. 1-13
[16]
A. Bergal, L. Loucif, D.E. Benouareth, A.A. Bentorki, C. Abat, J.M. Rolain.
Molecular epidemiology and distribution of serotypes, genotypes, and antibiotic resistance genes of Streptococcus agalactiae clinical isolates from Guelma, Algeria and Marseille, France.
Eur J Clin Microbiol Infect Dis, 34 (2015), pp. 2339-2348
[17]
D.L. Ippolito, W.A. James, D. Tinnemore, R.R. Huang, M.J. Dehart, J. Williams, et al.
Group B Streptococcus serotype prevalence in reproductive-age women at a tertiary care military medical center relative to global serotype distribution.
BMC Infect Dis, 10 (2010), pp. 336
[18]
E. Sadowy, B. Matynia, W. Hryniewicz.
Population structure, virulence factors and resistance determinants of invasive, non-invasive and colonizing Streptococcus agalactiae in Poland.
J Antimicrob Chemother, 65 (2010), pp. 1907-1914
[19]
G. Lindahl, M. Stålhammar-Carlemalm, T. Areschoug.
Surface proteins of Streptococcus agalactiae and related proteins in other bacterial pathogens.
Clin Microbiol Rev, 18 (2005), pp. 102-127
[20]
R. Beigverdi, F. Jabalameli, A. Mirsalehian, S. Hantoushzadeh, S. Boroumandi, M. Taherikalani, et al.
Virulence factors, antimicrobial susceptibility and molecular characterization of Streptococcus agalactiae isolated from pregnant women.
Acta Microbiol Immunol Hung, 61 (2014), pp. 425-434
[21]
B. Rojo-Bezares, J.M. Azcona-Gutiérrez, C. Martin, M.S. Jareño, C. Torres, Y. Sáenz.
Streptococcus agalactiae from pregnant women: antibiotic and heavy-metal resistance mechanisms and molecular typing.
Epidemiol Infect, 144 (2016), pp. 3205-3214
[22]
M.A. Herbert, C.J.E. Beveridge, N.J. Saunders.
Bacterial virulence factors in neonatal sepsis: group B Streptococcus.
Curr Opin Infect Dis, 17 (2004), pp. 225-229
[23]
A. Tazi, O. Disson, S. Bellais, A. Bouaboud, N. Dmytruk, S. Dramsi, et al.
The surface protein HvgA mediates group B Streptococcus hypervirulence and meningeal tropism in neonates.
J Exp Med, 207 (2010), pp. 2313-2322
[24]
S.M. Soto, M.T. Jimenez de Anta, J. Vila.
Quinolones induce partial or total loss of pathogenicity islands in uropathogenic Escherichia coli by SOS-dependent or -independent pathways, respectively.
Antimicrob Agents Chemother, 50 (2006), pp. 649-653
[25]
A.S. Domelier, N. Van der Mee-Marquet, L. Arnault, L. Mereghetti, P. Lanotte, A. Rosenau, et al.
Molecular characterization of erythromycin-resistant Streptococcus agalactiae strains.
J Antimicrob Chemother, 62 (2008), pp. 1227-1233
[26]
F. Capanna, S.P. Emonet, A. Cherkaoui, O. Irion, J. Schrenzel, B.M. De Tejada.
Antibiotic resistance patterns among group B Streptococcus isolates: implications for antibiotic prophylaxis for early-onset neonatal sepsis.
Swiss Med Wkly, 25 (2013), pp. 17-20
[27]
T.C. Pinto, N.S. Costa, A.R. Vianna Souza, L.G. Silva, A.B. Corrêa, F.G. Fernandes, et al.
Distribution of serotypes and evaluation of antimicrobial susceptibility among human and bovine Streptococcus agalactiae strains isolated in Brazil between 1980 and 2006.
Braz J Infect Dis, 17 (2013), pp. 131-136
[28]
C. Betriu, E. Culebras, I. Rodríguez-Avial, M. Gómez, B.A. Sánchez, J.J. Picazo.
In vitro activities of tigecycline against erythromycin-resistant Streptococcus pyogenes and Streptococcus agalactiae: mechanisms of macrolide and tetracycline resistance.
Antimicrob Agents Chemother, 48 (2004), pp. 323-325
[29]
M.A. De Francesco, S. Caracciolo, F. Gargiulo, N. Manca.
Phenotypes, genotypes, serotypes and molecular epidemiology of erythromycin-resistant Streptococcus agalactiae in Italy.
Eur J Clin Microbiol Infect Dis, 31 (2012), pp. 1741-1747
[30]
R.B. Schuab, G.P. Arêas, V.C. Souza, R.R. Barros.
Molecular epidemiology of Streptococcus agalactiae recovered from significant bacteriuria.
Infect Dis (Lond), 47 (2015), pp. 637-642
[31]
Y. Yan, H. Hu, T. Lu, H. Fan, Y. Hu, G. Li, et al.
Investigation of serotype distribution and resistance genes profile in group B Streptococcus isolated from pregnant women: a Chinese multicenter cohort study.
APMIS, 124 (2016), pp. 794-799
Copyright © 2017. Elsevier España, S.L.U. and Sociedad Española de Enfermedades Infecciosas y Microbiología Clínica
Opciones de artículo
Herramientas
es en pt

¿Es usted profesional sanitario apto para prescribir o dispensar medicamentos?

Are you a health professional able to prescribe or dispense drugs?

Você é um profissional de saúde habilitado a prescrever ou dispensar medicamentos

es en pt
Política de cookies Cookies policy Política de cookies
Utilizamos cookies propias y de terceros para mejorar nuestros servicios y mostrarle publicidad relacionada con sus preferencias mediante el análisis de sus hábitos de navegación. Si continua navegando, consideramos que acepta su uso. Puede cambiar la configuración u obtener más información aquí. To improve our services and products, we use "cookies" (own or third parties authorized) to show advertising related to client preferences through the analyses of navigation customer behavior. Continuing navigation will be considered as acceptance of this use. You can change the settings or obtain more information by clicking here. Utilizamos cookies próprios e de terceiros para melhorar nossos serviços e mostrar publicidade relacionada às suas preferências, analisando seus hábitos de navegação. Se continuar a navegar, consideramos que aceita o seu uso. Você pode alterar a configuração ou obter mais informações aqui.