Buscar en
Enfermedades Infecciosas y Microbiología Clínica
Toda la web
Inicio Enfermedades Infecciosas y Microbiología Clínica Infección ocular por Pythium insidiosum
Información de la revista
Vol. 31. Núm. 2.
Páginas 118-119 (Febrero 2013)
Compartir
Compartir
Descargar PDF
Más opciones de artículo
Vol. 31. Núm. 2.
Páginas 118-119 (Febrero 2013)
Carta científica
DOI: 10.1016/j.eimc.2012.07.012
Acceso a texto completo
Infección ocular por Pythium insidiosum
Pythium insidiosum ocular infection
Visitas
...
M. Carmen del Castillo-Jiméneza,??
Autor para correspondencia
mcjmenez70@hotmail.com

Autor para correspondencia.
, Nínive Baptista-Díaza, Jesús Monterob, Álvaro Pascuala
a Unidad de Microbiología y Enfermedades Infecciosas, Hospital Universitario Virgen Macarena, Sevilla, España
b Unidad de Oftalmología, Hospital Universitario Virgen Macarena, Sevilla, España
Información del artículo
Texto completo
Bibliografía
Descargar PDF
Estadísticas
Figuras (4)
Mostrar másMostrar menos
Texto completo

El género Pythium incluye organismos más relacionados con las algas y diatomeas que con los verdaderos hongos1. Este patógeno se encuadra dentro del Reino Stramenopila, Phylum Oomycota, Clase Oomycetes, Familia Pythiaceae. Su pared celular está compuesta por beta-glucanos y celulosa y carecen de ergosterol2. Se hallan distribuidos de forma global en suelos y medios acuáticos y se comportan como patógenos de plantas. Pythium insidiosum es un microorganismo único desde el punto de vista ecológico y fisiológico, que en contraste con otras especies de Pythium ha desarrollado la capacidad de causar patología en animales: la pitiosis es una enfermedad subcutánea, vascular, y con menor frecuencia intestinal en animales, descrita en países subtropicales y templados. Se caracteriza por el desarrollo de lesiones granulomatosas que crecen rápidamente y pueden ser muy graves en algunos casos3. En el hombre, la pitiosis suele estar asociada a alteraciones hematológicas, sobre todo pacientes talasémicos; la alfa-talasemia y la beta-talasemia son prevalentes en el sudeste de Asia, donde se han descrito series de casos1,4. Por el contrario, los casos de pitiosis ocular se han detectado, en su mayor parte, en pacientes sin enfermedades de base pero con posibles factores de riesgo, como traumatismo ocular previo, uso de lentes de contacto y baños en agua templada. Se han descrito casos en países de zonas tropicales (Haití, Tailandia, Malasia)1,5,6 y templadas (Australia, Israel)7,8. Los signos y síntomas de la pitiosis ocular pueden confundirse con los de las queratitis micóticas. El diagnóstico microbiológico se realiza mediante el examen microscópico en fresco o tras tinción y cultivo de muestras de tejido corneal (raspado). En el examen en fresco se observan hifas no tabicadas que pueden disponerse en ángulo recto. Puede ser necesario el empleo de técnicas moleculares para su identificación. Presentamos el primer caso de pitiosis ocular que se describe en Europa.

Se trata de una mujer de 41 años, residente en Huelva, usuaria de lentes de contacto blandas (no se pudieron constatar viajes, baños en aguas templadas ni otros factores de riesgo) que acude a nuestro centro por primera vez en septiembre de 2009 por úlcera corneal en el ojo derecho, que no cede al tratamiento convencional antibacteriano (colirio reforzado de vancomicina y ceftazidima). Tras la exploración oftalmológica habitual se realiza microscopia confocal de la córnea y se observan formas intraestromales compatibles con hifas de hongos, por lo que se instaura tratamiento con voriconazol tópico y sistémico. No hubo respuesta al tratamiento y se procede a realizar una queratoplastia en dicho ojo a los 15días. Tras un periodo de 10días con buena evolución, se apreció zona de infiltración de la queratoplastia y córnea circundante que fue progresando a pesar del tratamiento con antifúngicos tópicos y sistémicos (voriconazol y anfotericina B), así como antibióticos tópicos y sistémicos. Fue reintervenida mediante queratoplastia total de 12,5mm de diámetro sin conseguirse la remisión del cuadro de necrosis periférica y progresión de la infección, que requirió intervención de queratoplastias sectoriales previas. Finalmente, y ante la continua progresión de la infección —que en ningún caso fue sensible al tratamiento continuado con antibióticos y antifúngicos—, se procedió a la enucleación. Después de cada una de las intervenciones se enviaron al laboratorio de microbiología muestras de tejido corneal y de raspados corneales, que se procesaron para estudio de bacterias, hongos y amebas de vida libre. En total se estudiaron 2 muestras de tejido corneal y 2 de raspado corneal. En ninguna de las muestras se aislaron bacterias ni amebas de vida libre. En 3 de las muestras se observó, mediante examen en fresco, la presencia de estructuras compatibles con hifas. De todas ellas se obtuvo crecimiento del mismo microorganismo a los 3 días en los medios de cultivo habitual para bacterias, incluido el caldo tioglicolato, y también en Sabouraud tanto a 30°C como a 37°C. En este medio creció como un hongo que formaba colonias blanco-amarillentas con micelio sumergido, sin esporas y difícil de separar del agar (figs. 1 y 2). En el examen con azul de lactofenol se observaron hifas no tabicadas, ramificadas de forma articular, algunas de las cuales formaban ángulo recto (figs. 3 y 4).

Figura 1.

Pythium insidiosum. Crecimiento de la colonia en medio Sabouraud.

(0,12MB).
Figura 2.

Pythium insidiosum. Crecimiento de la colonia en medio Sabouraud.

(0,12MB).
Figura 3.

Pythium insidiosum. Tinción con azul de lactofenol.

(0,16MB).
Figura 4.

Pythium insidiosum. Tinción con azul de lactofenol.

(0,1MB).

Se amplificaron segmentos de ADN que comprenden la región ITS1 e ITS2 con primers ITS1 (5??3??TCCGTAGGTGAACCTGCGG) y ITS4 (5??3??TCCTCCGCTTATTGATATGC). Las mezclas de reacción contenía 0,5mM de cada cebador, 0,2mM de cada dNTP, 5l de tampón de PCR10X (Applied Biosystem, Madrid, España), 2,5U de Taq ADN polimerasa (Amplitaq, Applied Biosystem) y 5ng de ADN en un volumen final de 50l. Las muestras fueron amplificadas en un GeneAmp PCR System 2400 (Applied Biosystems), utilizando los parámetros de los ciclos: un ciclo inicial de 2min a 94° C, seguido de 35 ciclos de 30s a 94° C, 45s a 56° C y 2min a 72° C, y un ciclo final de 5min a 72° C. Los productos de reacción fueron analizados en un 1,3% en gel de agarosa.

La secuencia de reacciones se realizó utilizando 4l de un kit de secuenciación de ADN (BigDye Terminator Cycle Sequencing Listo Reacción, Applied Biosystem), 1mM de los cebadores (ITS1 y ITS4) y 5l del producto de PCR en un volumen final de 10l. Las secuencias fueron comparadas con el II SeqMan y paquetes de software EditsEq (DNAstar, Inc., Lasergene, Madison, EE.UU.). El análisis de la secuencia se realizó por comparación con las secuencias de nucleótidos de Pythium spp. con aislamientos obtenidos a partir del GenBank (http://www.ncbi.nih.gov/Genbank/). Después de analizar los segmentos de ADN que comprenden la región ITS1 e ITS2 y comparlas con las cepas de referencia, la secuencia del aislado clínico se emparejaron con las de P. insidiosum. Los porcentajes de similitud fueron >97% con las cepas de control. Todos los casos descritos tienen en común la aplicación inicial de antimicrobianos de forma más o menos prolongada, y una vez que se observa la presencia de hifas se aplica tratamiento antifúngico diverso: anfotericina B, ketoconazol, miconazol, itraconazol, natamicina, voriconazol1,6,7,9. La mayor parte de los casos requieren finalmente la enucleación por fracaso del tratamiento médico, aunque hay casos descritos de curación después de utilizar tratamiento antifúngico combinado con queratoplastia lamelar o penetrante, en ocasiones realizada de forma repetida1,6. El diagnóstico de pitiosis ocular requiere un alto grado de sospecha; son orientativas las características morfológicas del cultivo en medio sólido y líquido, lo que permitiría un tratamiento precoz mediante queratoplastia y antifúngicos, aunque aún no se conoce cuál es el más eficaz, o si se deben emplear en combinación.

Agradecimientos

A Manuel Cuenca Estrella.

Bibliografía
[1]
T. Krajaejun, B. Sathpatayavongs, R. Pracharktam.
Clinical and epidemiological analyses of human pythiosis in Thailand.
Clin Infect Dis, 43 (2006), pp. 569-576
[2]
A. De Cock, L. Mendoza, A.A. Padhye, L. Ajello, L. Kaufman.
Pythium insidiosum sp nov, the etiologic agent of pythiosis.
J Clin Microbiol, 25 (1987), pp. 344-439
[3]
L. Mendoza, F. Hernández, L. Ajello.
Life cycle of the human and animal oomycete pathogen Pythium insidiosum.
J Clin Microbiol, 31 (1993), pp. 2967-2973
[4]
P. Imwidthaya.
Human pythiosis in Thailand.
Postgrad Med J, 70 (1994), pp. 558-560
[5]
R. Virgile, H.D. Perry, B. Pardanani, K. Szabo, E.K. Rahn, J. Stone, et al.
Human infectious corneal ulcer caused by Pythium insidiosum.
Cornea, 12 (1993), pp. 81-83
[6]
P.R. Badenoch, D.J. Coster, B.L. Wetherall, H.T. Brettig, N.A. Rozenbilds, A. Drenth, et al.
Pythium insidiosum keratitis confirmed by DNA sequence analysis.
Br J Ophthalmol, 85 (2001), pp. 502-503
[7]
P.R. Badenoch, R.A. Mills, J.H. Chang, T.A. Sadlon, S. Klebe, D.J. Coster.
Pythium insidiosum keratitis in an Australian child.
Clin Experiment Ophthalmol, 37 (2009), pp. 806-809
[8]
T.Y. Tanhehco, R.C. Stacy, L. Mendoza, M.L. Durano, F.A. Jakobiec, K.A. Colby.
Pythium insidiosum keratitis in Israel.
Eye Contact Lenses, 37 (2011), pp. 96-98
[9]
D. Murdoch, D. Parr.
Pythium insidiosum keratitis.
Aust N Z J Ophthalmol, 25 (1997), pp. 177-179
Copyright © 2012. Elsevier España, S.L.. Todos los derechos reservados
Opciones de artículo
Herramientas
es en pt

¿Es usted profesional sanitario apto para prescribir o dispensar medicamentos?

Are you a health professional able to prescribe or dispense drugs?

Você é um profissional de saúde habilitado a prescrever ou dispensar medicamentos