Regístrese
Buscar en
Enfermedades Infecciosas y Microbiología Clínica
Toda la web
Inicio Enfermedades Infecciosas y Microbiología Clínica Identificación de Mycobacterium spp a través de métodos moleculares en el Lab...
Información de la revista
Vol. 34. Núm. 1.
Páginas 17-22 (Enero 2016)
Compartir
Compartir
Descargar PDF
Más opciones de artículo
Visitas
3500
Vol. 34. Núm. 1.
Páginas 17-22 (Enero 2016)
Original
DOI: 10.1016/j.eimc.2015.03.003
Acceso a texto completo
Identificación de Mycobacterium spp a través de métodos moleculares en el Laboratorio de Salud Pública de Bogotá, Colombia
Identification of mycobacteria to the species level by molecular methods in the Public Health Laboratory of Bogotá, Colombia
Visitas
3500
Johana Esther Hernández-Toloza
Autor para correspondencia
jhernandezto@gmail.com

Autor para correspondencia.
, María de Pilar Rincón-Serrano, Yamile Adriana Celis-Bustos, Claudia Inés Aguillón
Laboratorio de Salud Pública, Secretaria Distrital de Salud, Bogotá, Colombia
Este artículo ha recibido
3500
Visitas
Información del artículo
Resumen
Texto completo
Bibliografía
Descargar PDF
Estadísticas
Figuras (1)
Tablas (2)
Tabla 1. Resultados de la identificación a través de las pruebas bioquímicas, PRA y PCR múltiplex
Tabla 2. Resultados del análisis de secuenciación
Mostrar másMostrar menos
Resumen
Introducción

Globalamente la situación epidemiológica de la enfermedad por micobacterias no tuberculosas (MNT) es desconocida debido a que no es una enfermedad de notificación en la mayoría de los países, sin embargo los diversos reportes de infecciones y brotes por MNT publicados sugieren su creciente incremento en los últimos años. Tradicionalmente la identificación se realiza a través de metodologías bioquímicas, las cuales permiten la diferenciación inicial entre M. tuberculosis y MNT, y en algunos casos la identificación de la especie micobacteriana. Sin embargo, esta metodología tiene importantes limitaciones técnicas y la obtención de resultados requiere tiempos prolongados. Por otra parte, la introducción de metodologías basadas en biología molecular ha facilitado significativamente el diagnóstico de las MNT desde el laboratorio.

Objetivo

Establecer la frecuencia de MNT en los cultivos positivos para bacilos ácido alcohol resistentes remitidos al Laboratorio de Salud pública de Bogotá en un período de 12 meses.

Materiales y métodos

Un total de 100 cultivos provenientes de hospitales públicos y privados de Bogotá fueron identificados a través de pruebas bioquímicas y de las metodologías moleculares; PRA (PCR-análisis de restricción) y PCR múltiplex. Así mismo, la presencia de especies de baja prevalencia, así como el estudio de los casos no concluyentes se realizó través de análisis de secuenciación del blanco molecular 16SrDNA.

Resultados

El estudio identificó MNT en el 11% de los cultivos a través de la metodología PRA. Adicionalmente, esta metodología molecular permitió detectar la ocurrencia de más de una especie micobacteriana en el 4% de los cultivos evaluados. Interesantemente un nuevo patrón de restricción-PRA para la especie M. kubicae es reportado en nuestro estudio.

Conclusión

El uso de un algoritmo de identificación micobacteriana que incluya la metodología molecular PRA incrementa el poder diagnóstico de los métodos convencionales, y contribuye al mejor conocimiento de la epidemiología de las MNT y control de las micobacteriosis.

Palabras clave:
Micobacteria no tuberculosa
Reaccion en cadena de la polimerasa múltiple
análisis con enzimas de restricción
Abstract
Introduction

Global epidemiology of non-tuberculous mycobacteria (NTM) is unknown due to the fact that notification is not required in many countries, however the number of infection reports and outbreaks caused by NTM suggest a significant increase in the last years. Traditionally, mycobacteria identification is made through biochemical profiles which allow to differentiate M. tuberculosis from NTM, and in some cases the mycobacteria species. Nevertheless, these methods are technically cumbersome and time consuming. On the other hand, the introduction of methods based on molecular biology has improved the laboratory diagnosis of NTM.

Objective

To establish the NTM frequency in positive cultures for acid-fast bacilli (AAFB) which were sent to Laboratorio de Salud Pública de Bogotá over a 12 month period.

Materials and methods

A total of 100 positive cultures for acid-fast bacilli from public and private hospitals from Bogotá were identified by both biochemical methods and the molecular methods PRA (PCR-restriction enzyme analysis) and multiplex-PCR. Furthermore, low prevalence mycobacteria species and non-interpretable results were confirmed by 16SrDNA sequentiation analysis.

Results

Identification using the PRA method showed NMT occurrence in 11% of cultures. In addition, this molecular methodology allowed to detect the occurrence of more than one mycobacteria in 4% of the cultures. Interestingly, a new M. kubicae pattern of PCR-restriction analysis is reported in our study.

Conclusion

Using a mycobacteria identification algorithm, which includes the molecular method PRA, improves the diagnostic power of conventional methods and could help to advance both NTM epidemiology knowledge and mycobacteriosis control.

Keywords:
Non-tuberculous mycobacteria
Multiplex polymerase chain reaction
Restriction enzyme analysis
Texto completo
Introducción

Las micobacterias no tuberculosas (MNT) pueden ser saprofitas, patógenas u oportunistas y adicionalmente de rápido y de lento crecimiento1. En la actualidad se han descrito más de 150 especies2,3, y aunque estos microorganismos son agentes causales de enfermedad su patogenicidad varía entre especies4.

Por otra parte, hay limitada evidencia de transmisión de MNT persona-persona; se han descrito brotes causados por exposición al mismo reservorio5,6 y varios reservorios han sido claramente identificados para algunas de las especies micobacterianas; animales marinos para M. marinum, tuberías para M. avium complex y agua de grifo para M. gordonae, entre otros7. Así mismo las MNT han sido frecuentemente asociadas a diversas condiciones de salud, siendo agentes causales de enfermedad en poblaciones de pacientes con fibrosis quística, enfermedad pulmonar crónica, virus de la inmunodeficiencia humana y otras condiciones inmunosupresoras6–9.

A nivel global, la situación epidemiológica de la enfermedad por MNT es desconocida debido a que no es una enfermedad de notificación en la mayoría de los países; sin embargo los diversos reportes de infecciones y brotes por MNT publicados sugieren incrementos en la proporción de casos atribuidos a estos agentes infecciosos10. En Colombia se han descrito series de casos de infecciones oportunistas y hospitalarias causadas por MNT11,12, así como brotes en pacientes sometidos a mesoterapia13. Así mismo, un estudio realizado en pacientes infectados con el virus de la inmunodeficiencia humana aisló MNT en el 5,3% al 28% de los casos14. Sin embargo, en Colombia se desconoce la prevalencia de micobacteriosis debido a la falta de conocimiento de estas especies como causantes de enfermedad, y a limitaciones para su diagnóstico, el cual se realiza principalmente a través pruebas bioquímicas, a pesar del amplio conocimiento en la técnica molecular PRA (PCR-análisis de restricción)13,15-17.

Tradicionalmente, el diagnóstico de MNT se basa en pruebas bioquímicas, las cuales tardan varias semanas, son dispendiosas y algunas veces no logran diferenciar entre miembros de complejos18. Sin embargo, la descripción de la metodología de identificación molecular mediante reacción en cadena de la polimerasa PCR-análisis de restricción del gen hsp65 se ha convertido en una herramienta útil para la identificación rápida de micobacterias a un nivel inferior al de especie, y estudios globales han confirmado la reproducibilidad de la técnica17, así como su utilidad para la identificación directa de la especie desde la muestra clínica en corto tiempo y con alta especificidad19.

Actualmente otras metodologías basadas en métodos moleculares —PCR múltiplex, PCR-hibridación— han sido exitosamente evaluadas para la identificación de micobacterias tuberculosas y no tuberculosas20,21. Así mismo, los recientes avances en espectrometría de masas han hecho posible el uso de la técnica matrix-assisted laser desorption ionization- time-of-flight para identificar de forma reproducible las diferentes especies de micobacterias mediante la obtención de un espectro de masas único para cada una de estas22.

Materiales y métodosMuestras de cultivos

Un total de 107 cultivos positivos para BAAR fueron remitidos al Laboratorio de Salud Pública de Bogotá durante 12 meses. Los cultivos se obtuvieron a partir de muestras de pacientes que acudieron a diferentes centros hospitalarios públicos y privados de la ciudad. En la mayoría de los casos no fue posible obtener información de la velocidad de crecimiento y pigmentación de los cultivos. Así mismo, un total de 20 cultivos de las cepas control M. fortuitum ATCC 6841, M. avium ATCC 15769 y M. tuberculosis ATCC 25177 se incluyeron como controles, para lo cual se analizaron en ciego a través de las metodologías moleculares.

La identificación bioquímica se llevó a cabo a través de las pruebas bioquímicas catalasa 37°C, catalasa 68°C, nitratos y niacina, o la metodología comercial TBc i test (Becton, Dickinson, EE. UU.) las cuales permiten únicamente la diferenciación entre M. tuberculosis y MNT.

Extracción del ADN

El ADN fue extraído y obtenido a partir de todas las suspensiones de los cultivos previamente identificados a través de las metodologías fenotípicas mediante el kit comercial QUIamp DNA mini and Blood Mini (Quiagen) con algunas modificaciones. Brevemente, la suspensión de colonias fue resuspendida en el buffer de extracción (20mM Tris-HCl pH 8; 2mM EDTA, 1,2% Triton; Lisozyma 20mg/ml), incubadas 30min/37°C, las proteínas fueron depletadas con proteinasa K. Seguidamente se adicionó el buffer AL y se incubó a 56°C/30min, se precipitó con etanol absoluto y se purifico a través de las columnas provistas por el kit, el ADN se resuspendió en buffer AE. El ADN extraído fue cuantificado a través de electroforesis en gel de agarosa al 0,8%, y fue almacenado a –20°C hasta su uso.

Metodología reacción en cadena de la polimerasa-análisis de restricción

Para la identificación molecular se siguió el procedimiento descrito por Telenti et al.23. Primero se amplificó un fragmento de 439bp a partir del ADN extraído de los cultivos de M. tuberculosis, empleando los oligonucleótidos TB11 (5’ ACCAACGATGGTGTGTCCAT) y TB12 (5’ CTTGTCGAACCGCATACCCT), a continuación el producto de la PCR se llevó a digestión con las endonucleasas HaeIII y BstEII. Finalmente, los productos digeridos fueron evaluados en un gel de agarosa al 3%, y la identificación de la especie micobacteriana se realizó siguiendo las recomendaciones establecidas en el sitio Web: http://app.chuv.ch/prasite, así como mediante comparación con otros algoritmos publicados24.

Reacción en cadena de la polimerasa múltiplex

Para la identificación molecular se siguió el procedimiento descrito por Chia et al.20. Nueve pares de iniciadores fueron empleados para la identificación de 9 especies micobacterianas. Primero, para la detección de micobacterias de lento crecimiento se emplearon 7 pares de iniciadores, 6 de los cuales tienen como blanco molecular la región 16S–23S rRNA ITS-1 y el séptimo para la detección de un fragmento del gen que codifica para el antígeno ESAT-6 específico de M. tuberculosis complex (MTBC) TBF1a GTGGGGCGTAGGCCGTGA y TBR ACCTGGAACAAGTCCGAGTG, M. avium-intracellulare complex MACF CCCTGAGACAACACTCGGTC y MACR1a GAAATTACACATTTCGATGAAC, M. gordonae GORF CGACAACAAGCTAAGCCAGA GORR CAACGCATACATTTTGATGC, M. scrofulaceum SCOF TCGGCTCGTTCTGAGTGGTG y SCOR1a CGGCCACGCATCCGTTTA, M. kansasii MKF1a TCGGGCGCCCACCAGGAAT y MKR1a CGGCCCCGGACTTCTTTCGT, M. szulgai SZUF AACACTCAGGCTTGGCCAGA y SZUR GAGGGCAGCGCATCCAATTG, MTBC/M. kansasii/M. marinum ESAT-F GATCCCATGACAGAGCAGCAGT y ESAT-R TCTGCAGCGCGTTGTTCAGCT por otra parte, para la identificación de micobacterias rápido crecimiento; un par de iniciadores tiene como blanco la ITS-1, y el otro amplifica un fragmento del gen hsp65; M. fortuitum complex MFOR-F GCTGAGCTCGTCAAAGAGGTC y MFOR-R CACCTCCTTGGCGGACTTCAGG, M. chelonae-abscessus complex CHEF1a TGGTTACTCGCTTGGTGAATAT y CHER1a CCAGCGTTTCAATTCTATTGA. La mezcla de reacción de PCR se preparó con 1×PCR buffer, 0,5U of HotStarTaq DNA polimerasa (Invitrogen), 200μmol/l of each deoxinucleotido trifosfato, y 0,2μmol/l de cada iniciador. El ciclo de amplificación consistió de una denaturación inicial a 95°C/15min y luego 35 ciclos de denaturación a 95°C/1min, anillaje a 60°C (para lentas crecedoras) o 55°C (para rápidas crecedoras)/1min, y extensión a 72°C/1min. El tamaño de los productos de PCR fue evaluado mediante electroforesis en agarosa al 3%.

Análisis de secuenciación 16SrDNA

Las muestras con resultados inconcordantes se llevaron a amplificación para el blanco molecular 16SrDNA utilizando los iniciadores universales. Los productos se analizaron mediante secuenciación comercial. Los cromatogramas se analizaron en el programa BioEdit v7.2.5, y las secuencias nucleotídicas obtenidas fueron analizadas mediante el programa BLAST (www.ncbi.nlm.nhi.gov) y la base de datos de Ribosomal Differentiation of Medical Microorganisms (RIDOM) (http://www.ridom.de). Para los análisis de 16SrDNA la identificación de especie fue confirmada si la secuencia nucleotídica obtenida presentaba una similitud99%.

Resultados

Un total de 107 cultivos de micobacterias obtenidos de pacientes de Bogotá entre el 11 de enero de 2013 y el 01 de diciembre de 2013 fueron incluidos en nuestro estudio.

De los 107 cultivos 7 no pudieron incluirse dentro del análisis debido a que 5 estaban contaminados, y 2 correspondieron a cultivos duplicados, por lo cual un total de 100 muestras se analizaron de forma independiente a través de cada una de las metodologías seleccionadas (tabla 1).

Tabla 1.

Resultados de la identificación a través de las pruebas bioquímicas, PRA y PCR múltiplex

MetodologíaResultado  P. bioquímicas  PRA  PCR múltiplex 
M. tuberculosis  66  83  89 
MNT  26  11(2M.avium, 2M. gordonae, 3M. kubicae, M. brumae, M. intracelulare, M. fortuitum, M. abscessus7(3M.avium, 2M. gordonae, M. fortuitum, M. chelonae
Mixtaa  No procede 
Inconcluyenteb 
Total  100  100  100 

Cambios efectuados: n.° referencia 6, 19, 31.

a

Presencia de M. tuberculosis y MNT en simultáneo en el cultivo.

b

No fue posible obtener un resultado compatible con micobacterias a través de la metodología utilizada.

Un total de 83 cultivos fueron identificados como M. tuberculosis a través de PRA, de los cuales 82 fueron concordantes con los resultados arrojados por la PCR múltiplex; y el restante cultivo no mostró amplificación para los blancos moleculares evaluados. Así mismo, las pruebas bioquímicas solo concordaron en identificar M. tuberculosis en 66 cultivos, mientras que en 13 casos sugirieron presencia de MNT y en 4 resultados no concluyentes.

En cuanto a la identificación de MNT, mientras PRA permitió identificar MNT en 11 cultivos, la PCR múltiplex identificó MNT en 7 cultivos; un cultivo identificado como M. intracellulare a través de PRA fue identificado como M. avium a través de esta metodología, un M. abscessus fue clasificado como M. chelonae y M. brumae como M. tubeculosis. En 2 cultivos no se obtuvo amplificación. En cuanto a los resultados de la identificación bioquímica se encontraron resultados concordantes para 10 de los cultivos identificados como MNT mediante PRA; y el cultivo identificado como M. brumae fue identificado como M. tubeculosis. Este cultivo fue posteriormente analizados a través de secuenciación 16SrDNA (tabla 2) que sugirió la presencia de M. brumae.

Tabla 2.

Resultados del análisis de secuenciación

Cultivo  PRA  PCR múltiplex  Secuenciación  Pruebas fenotípicas 
2856  Perfil incompatible para análisis  No amplifica para los blancos moleculares evaluados  No micobacteria  Contaminado 
6276  M. gordonae  M. gordonae  M. gordonae  NT 
34918  M. intracellulare o M. chimaera  M. avium  M. intracelulare  NT 
35835  Perfil no compatible con los reportados  No amplifica para los blancos moleculares evaluados  M. kubicae  NT 
35844  Perfil no compatible con los reportados  No amplifica para los blancos moleculares evaluados  M. kubicae  NT 
37643  Perfil no compatible con los reportados  M. tuberculosis  M. kubicae  NT 
42589  M. brumae  M. tuberculosis  M. brumae  M .tuberculosis 
43664  Perfil no compatible para análisis  M. tuberculosis  No micobacteria  NT 

Es importante resaltar que en 3 de los cultivos identificados como MNT a través de PRA, los cuales mostraron idéntico patrón de restricción, los algoritmos disponibles no permitieron definir la especie micobacteriana, por lo cual las muestras fueron analizadas a través de secuenciación 16SrDNA, que permitió establecer la presencia de M. kubicae en todos los casos (tabla 2 y fig. 1).

Figura 1.

Resultados del análisis de restricción a través de la metodología molecular PRA.

(0,07MB).

Por otra parte, la metodología PRA permitió detectar la ocurrencia de infecciones mixtas, en nuestro caso M. tubeculosis y MNT simultáneamente en 4 cultivos. Sin embargo, estos cultivos fueron identificados como M. tubeculosis a través de la PCR múltiplex, y en 3 casos como MNT a través de las pruebas bioquímicas.

Extrañamente 2 cultivos no pudieron ser analizados a través de PRA, ya que se obtuvo resultados positivos a través de la amplificación, pero los patrones de restricción fueron totalmente incompatibles a los algoritmos disponibles. Uno de estos cultivos se identificó como M. tubeculosis a través de PCR múltiplex y el otro no amplificó, mientras que la identificación bioquímica identificó uno como MNT y otro mostró resultados no concluyentes. Estos 2 cultivos fueron analizados posteriormente mediante secuenciación 16SrDNA, la cual sugirió la presencia de otros géneros bacterianos (tabla 2).

En cuanto a los resultados de la identificación del total de los cultivos control mostraron 100% de concordancia en los resultados obtenidos a través de las 3 metodologías utilizadas.

Discusión

Las metodologías moleculares han mostrado alto poder diagnóstico para la diferenciación de micobacterias25,26. Sin embargo, métodos fenotípicos basados en pruebas bioquímicas continúan siendo la metodología estandarizada para la identificación de las especies micobacterianas en un amplio número de laboratorios26,27.

En este estudio el 26% de los cultivos estudiados mostraron resultados compatibles para MNT a través de las pruebas bioquímicas, sin embargo a través de las metodologías moleculares PRA y PCR múltiplex se encontraron frecuencias de MNT del 11% y 7% respectivamente; esta notoria diferencia en los resultados obtenidos podría atribuirse a las conocidas limitaciones de las metodologías fenotípicas: a) baja reproducibilidad; b) los fenotipos esperados no son absolutos y pueden mostrar sustancial variabilidad; y c) la base de datos de las características fenotípicas está limitada a especies comunes28. Así mismo, las metodologías moleculares permiten obtener resultados satisfactorios con un bajo número de colonias, y aun en cultivos almacenados por largos periodos de tiempo; factores que contrariamente en las pruebas bioquímicas son indispensables para la obtención de resultados24.

Estos hallazgos sugieren la necesidad de complementar las metodologías fenotípicas con otros métodos de mayor poder diagnóstico29, y resaltan la importancia de confirmar la presencia de una MNT en por lo menos 2 muestras diferentes ante la sospecha de micobacteriosis4,15,30.

En el 82% (9 de 11) de los casos de MNT encontrados en este estudio a través de PRA fue posible establecer la especie micobacteriana a través de los patrones publicados en http://app.chuv.ch/prasite, resultados que fueron 100% concordantes con el análisis de secuenciación, hecho que confirma el alto poder diagnóstico de la metodología PRA para la identificación de micobacterias15,17,26,31. Sin embargo, para el 18% faltante (3 de 11) no fue posible establecer con certeza la especie debido a que los patrones de restricción reportados fueron incompatibles con nuestros hallazgos, situación que ha sido documentada en otros estudios32. Finalmente, la identificación de estos aislamientos con idéntico perfil de restricción fue posible con el análisis de secuenciación que sugirió para los 3 casos la presencia M. kubicae. Interesantemente, nuestros resultados evidencian un nuevo perfil de restricción (fig. 1) que podrá ser considerado ante la sospecha de M. kubicae; micobacteria de lento crecimiento, escotocromógena y hasta la fecha no reportada como agente causal de infección29. Interesantemente en este estudio la metodología molecular PRA permitió la identificación de esta especie en 3 cultivos obtenidos de 3 pacientes, en el mismo periodo de tiempo y en el mismo centro hospitalario; sin embargo, para ninguno de los casos fue posible reconfirmar la infección por esta MNT, ya que no fue posible la obtención de una segunda muestra para ningún caso, hecho que sugiere la ocurrencia de colonización por esta micobacteria o más posiblemente contaminación cruzada en el laboratorio.

En cuanto a los resultados obtenidos a través de la PCR múltiplex en el 6% de los cultivos no se obtuvo amplificación para los blancos evaluados, lo cual obedece a una limitación de la técnica, que únicamente detecta 7 de las especies micobacterianas más frecuentes20; sin embargo, el creciente número de MNT causantes de infección33 y el poco conocimiento que se tiene acerca de la epidemiología de estos agentes infecciosos en Colombia15 requiere de metodologías que permitan la identificación de un amplio rango de micobacterias4,25.

Entre los hallazgos interesantes, en un caso identificado como M. tuberculosis a través de las metodologías fenotípicas y PCR múltiplex la metodología PRA detectó la presencia de M. brumae, resultado que se confirmó a través de análisis de secuenciación 16SrDNA; estos resultados coinciden con hallazgos previamente reportados que sugieren baja concordancia entre las pruebas fenotípicas y esta metodología molecular, así como a la limitación de las pruebas fenotípicas y PCR múltiplex para identificar únicamente especies micobacterianas comunes31,28. Por otra parte, en 2 cultivos no pudo llevarse a cabo el análisis de restricción PRA a pesar de contar con resultados positivos para la PCR hsp65, hecho que puede explicarse por la presencia de este blanco molecular en otros géneros bacterianos34, y que pudo esclarecerse con los resultados del análisis de secuenciación que sugirieron ausencia de micobacterias.

Hwang et al.35 detectaron la ocurrencia en simultáneo de infecciones mixtas por micobacterias tuberculosas y no tuberculosas a través de la metodología molecular GenoBlot Assay. En nuestro estudio la metodología molecular PRA nos permitió identificar la coexistencia de más de una micobacteria en un cultivo, siendo esta una de las bondades de esta metodología molecular, y lo cual en la práctica clínica resulta de gran interés para el éxito terapéutico4.

Con la discrepancia observada entre los resultados arrojados por las diferentes metodologías evaluadas en este estudio, y la ocurrencia de patrones PRA no compatibles con lo reportado32, la utilización de herramientas robustas como la secuenciación36 nos permitió confirmar o excluir la presencia micobacteriana, así como identificar con certeza la especie, resultados que indican el valor diagnóstico de esta metodología como apoyo para el análisis e interpretación de casos especiales como los observados en nuestro estudio.

Estudios previos realizados en Colombia37 empleando metodologías de identificación fenotípica registraron un total de 19 casos por MNT para el año 2003, resultados que no muestran variaciones significativas frente a nuestros hallazgos; identificación fenotípica 25% (22 de 89), PRA 12% (11 de 89) y PCR múltiplex 11% (10 de 89), sin embargo la comparación de resultados de las pruebas fenotípicas estuvo limitada en este estudio al hecho de que la identificación fenotípica realizada correspondió únicamente a la diferenciación de micobacterias tuberculosas de MNT, sin llegar a definir la especie. Así mismo, la notoria diferencia en la frecuencia de MNT obtenida a través de las metodologías fenotípicas vs las pruebas moleculares empleadas en este estudio puede ser explicada por el alto poder diagnóstico de estas últimas17,23,31, las cuales discriminaron la presencia de más de una micobacteria en simultáneo; cultivos identificados como MNT por metodologías fenotípicas fueron identificados como cultivos mixtos de M. tuberculosis y MNT a través del análisis molecular. Interesantemente, un estudio multicéntrico que investigo 36.099 aislados de muestras clínicas de pacientes provenientes de 14 países identificó como especies más frecuentes Mycobacterium avium complex, M. gordonae, M. xenopi, M. kansasii y M. fortuitum38. Así mismo, Castro et al.15 en Colombia, utilizando la metodología PRA para la identificación de 70 cultivos de MNT recolectados durante 11 años de todo el país, reportaron como especies prevalentes: M. fortuitum, M. abscessus, M. gordonae, M. chelonae y M. intracelulare; a pesar de las notorias diferencias entre los estudios mencionados concernientes a tamaño y tipo de muestra nuestros resultados muestran concordancia en las especies de MNT detectadas, y nosotros encontramos en el 63% de las MNT aisladas M. avium, M. gordonae, M. abscessus y M. fortuitum.

Conclusión

El uso de un algoritmo de identificación micobacteriana que incluya la metodología molecular PRA incrementa el poder diagnóstico de los métodos convencionales, y contribuye significativamente al mejor conocimiento de la epidemiología y control de la infección por MNT.

Financiación

El presente trabajo fue desarrollado con fondos del Laboratorio de Salud Pública de Bogotá.

Conflicto de intereses

Los autores declaran no tener ningún conflicto de intereses.

Bibliografía
[1]
B.A. Brown-Elliott, R.J. Wallace Jr..
Clinical and taxonomic status of pathogenic nonpigmented or late-pigmenting rapidly growing mycobacteria.
Clin Microbiol Rev, 15 (2002), pp. 716-746
[2]
C. Piersimoni, C. Scarparo.
Pulmonary infections associated with non-tuberculous mycobacteria in immunocompetent patients.
Lancet Infect Dis, 8 (2008), pp. 323-334
[3]
J. van Ingen, S.A. Bendien, W.C. de Lange, W. Hoefsloot, P.N. Dekhuijzen, M.J. Boeree, et al.
Clinical relevance of non-tuberculous mycobacteria isolated in the Nijmegen-Arnhem region, The Netherlands.
Thorax, 64 (2009), pp. 502-506
[4]
D.E. Griffith, T. Aksamit, B.A. Brown-Elliott, A. Catanzaro, C. Daley, F. Gordin, et al.
An official ATS/IDSA statement: Diagnosis, treatment, and prevention of nontuberculous mycobacterial diseases.
Am J Respir Crit Care Med, 175 (2007), pp. 367-416
[5]
J.M. Bryant, D.M. Grogono, D. Greaves, J. Foweraker, I. Roddick, T. Inns, et al.
Whole-genome sequencing to identify transmission of mycobacterium abscessus between patients with cystic fibrosis: A retrospective cohort study.
Lancet, 381 (2013), pp. 1551-1560
[6]
M.L. Aitken, A. Limaye, P. Pottinger, E. Whimbey, C.H. Goss, M.R. Tonelli, et al.
Respiratory outbreak of mycobacterium abscessus subspecies massiliense in a lung transplant and cystic fibrosis center.
Am J Respir Crit Care Med, 185 (2012), pp. 231-232
[7]
P.W. Lowry, C.M. Beck-Sague, L.A. Bland, S.M. Aguero, M.J. Arduino, A.N. Minuth, et al.
Mycobacterium chelonae infection among patients receiving high-flux dialysis in a hemodialysis clinic in California.
J Infect Dis, 161 (1990), pp. 85-90
[8]
H. Kotilainen, V. Valtonen, P. Tukiainen, T. Poussa, J. Eskola, A. Jarvinen.
Clinical symptoms and survival in non-smoking and smoking HIV-negative patients with non-tuberculous mycobacterial isolation.
Scand J Infect Dis, 43 (2011), pp. 188-196
[9]
W. Hoefsloot, J. van Ingen, E.J. Peters, C. Magis-Escurra, P.N. Dekhuijzen, M.J. Boeree, et al.
Mycobacterium genavense in the Netherlands: An opportunistic pathogen in HIV and non-HIV immunocompromised patients. An observational study in 14 cases.
Clin Microbiol Infect, 19 (2012), pp. 432-437
[10]
J.E. Moore, M.E. Kruijshaar, L.P. Ormerod, F. Drobniewski, I. Abubakar.
Increasing reports of non-tuberculous mycobacteria in England, Wales and Northern Ireland, 1995-2006.
BMC Public Health, 10 (2010), pp. 612
[11]
M.I. Murcia-Aranguren, J.E. Gómez-Marín, F.S. Alvarado, J.G. Bustillo, E. de Mendivelson, B. Gomez, et al.
Frequency of tuberculous and non-tuberculous mycobacteria in HIV infected patients from Bogotá, Colombia.
BMC Infect Dis, 1 (2001), pp. 21
[12]
D. Camargo, C. Saad, F. Ruiz, M.E. Ramírez, M. Lineros, G. Rodríguez, et al.
Iatrogenic outbreak of M. chelonae skin abscesses.
Epidemiol Infect, 177 (1996), pp. 113-119
[13]
N. Correa1, J. Catano, G. Mejia, T. Realpe, B. Orozco, S. Estrada, et al.
Outbreak of mesotherapy-associated cutaneous infections caused by Mycobacterium chelonae in Colombia.
Jpn J Infect Dis, 63 (2010), pp. 143-145
[14]
C.I. León, Y. Jiménez, O.J. López, J. Pavas, J.G. Bustillo, M.I. Guerrero.
Evolución de la asociación micobacteriana HIV-sida en Bogotá 1995-2003.
Infectio, 8 (2004), pp. 99
[15]
C. Castro, G. Puerto, L.M. García, D. Orjuela, C. Polo, M. Garzón, et al.
Identificación molecular de micobacterias no tuberculosas mediante el análisis de los patrones de restricción, Colombia 1995-2005..
Biomédica, 27 (2007),
[16]
J.E. Hernández, M.I. Murcia, F. de la Hoz.
Molecular epidemiology of tuberculosis in Bogotá in clinical isolates obtained over an 11-year period.
Rev Salud Pública (Bogota), 10 (2008), pp. 126-136
[17]
S.C. Leao, A. Bernardelli, A. Cataldi, M. Zumarraga, J. Robledo, T. Realpe, et al.
Multicenter evaluation of mycobacteria identification by PCR restriction enzyme analysis in laboratories from Latin America and the Caribbean.
J Microbiol Methods, 61 (2005), pp. 193-199
[18]
S.X. Wang, L. Tay, L.H. Sing.
Rapid identification of pathogenic rapidly growing mycobacteria by PCR-restriction endonuclease analysis.
Ann Acad Med Singapore, 34 (2005), pp. 137-140
[19]
D1 Orjuela, G. Puerto, G. Mejía, C. Castro, M.C. Garzón, L.M. García, et al.
Cutaneous tuberculosis after mesotherapy: Report of six cases.
Biomedica, 30 (2010), pp. 321-326
[20]
J. Chia, T. Wu, L. Su, A. Kuo, H. Lai.
Direct identification of mycobacteria from smear-positive sputum samples using an improved multiplex polymerase chain reaction assay.
Diagnostic Microbiology and Infectious Disease, 72 (2012), pp. 340-349
[21]
E. Tortoli, A. Mariottini, G. Mazzarelli.
Evaluation of INNO-LiPA Mycobacteria v2: Improved reverse hybridization multiple DNA probe assay for mycobacterial identification.
J Clin Microbiol, 41 (2003), pp. 4418-4420
[22]
M. Pignone, K.M. Greth, J. Cooper, D. Emerson, J. Tang.
Identification of mycobacteria by matrix-assisted laser desorption ionization-time-of-flight mass spectrometry.
J Clin Microbiol, 44 (2006), pp. 1963-1970
[23]
A. Telenti, F. Marchesi, M. Balz, F. Bally, E.C. Bötter, T. Bodmer.
Rapid identification of mycobacteria to the species level by polymerase chain reaction and restriction enzyme analysis.
J Clin Microbiol, 31 (1993), pp. 175-178
[24]
A. Devallois, K.S. Goh, N. Rastogi.
Rapid identification of mycobacteria to species level by PCR-restriction fragment length polymorphism analysis of the hsp65 gene and proposition of an algorithm to differentiate 34 mycobacteria species.
J Clin Microbiol, 35 (1997), pp. 2969-2973
[25]
A. Singh, A. Maurya, J. Umrao, S. Kant, R. Kushwaha, V. Nag, et al.
Role of GenoType® Mycobacterium common mycobacteria/additional species assay for rapid differentiation between Mycobacterium tuberculosis complex and different species of non-tuberculous mycobacteria.
J Lab Physicians, 5 (2013), pp. 83-89
[26]
E. Chimara, L. Ferrazoli, S.Y. Ueki, M.C. Martins, A.M. Durham, R.D. Arbeit, et al.
Reliable identification of mycobacterial species by PCR-restriction enzyme analysis (PRA)-hsp65 in a reference laboratory and elaboration of a sequence-based extended algorithm of PRA-hsp65 patterns.
BMC Microbiol, 20 (2008), pp. 48
[27]
S. Shenai, C. Rodrigues, A. Mehta.
Time to identify and define non-tuberculous mycobacteria in a tuberculosis-endemic region.
Int J Tuberc Lung Dis, 14 (2010), pp. 1001-1008
[28]
B. Springer, L. Stockman, K. Teschner, G.D. Roberts, E.C. Bottger.
Two-laboratory collaborative study on identification of mycobacteria: Molecular versus phenotypic methods.
J Clin Microbiol, 34 (1996), pp. 296-303
[29]
M.M. Floyd, W.M. Gross, D.A. Bonato, V.A. Silcox, R.W. Smithwick, B. Metchock, et al.
Mycobacterium kubicae sp. nov.a slowly growing, scotochromogenic Mycobacterium.
Int J Syst Evol Microbiol, 50 (2000), pp. 1811-1816
[30]
M. Salfinger, A. Somoskovi.
Nontuberculous mycobacteria in respiratory infections: Advances in diagnosis and identification.
Clin Lab Med, 34 (2014), pp. 271-295
[31]
C. Da Silva, S. Misuka, D. Cássia, S. Cardoso.
Hsp65 PCR–restriction enzyme analysis (PRA) for identification of mycobacteria in the clinical laboratory.
Rev Inst Med Trop Sao Paulo, 43 (2001), pp. 25-28
[32]
O. Esparcia, M. Español, M. Garrigó, C. Moreno, M. Montemayor, F. Navarro, et al.
Utilización de diferentes técnicas de biología molecular integradas en un algoritmo de identificación de micobacterias no tuberculosas.
Enferm Infecc Microbiol Clin, 30 (2012), pp. 3-10
[33]
S. Suomalainen, E. Iivanainen, E. Tortoli, M. Suutari, J. Seppänen, L. Paulin, et al.
Mycobacterium palustre sp. nov., a potentially pathogenic, slowly growing mycobacterium isolated from clinical and veterinary specimens and from Finnish stream waters.
Int J Syst Evol Microbiol, 52 (2002), pp. 1519-1525
[34]
V. Rodríguez-Nava, A. Couble, G. Devulder, J.P. Flandrois, P. Boiron, F. Laurent.
Use of PCR-restriction enzyme pattern analysis and sequencing database for hsp65 gene-based identification of Nocardia species.
J Clin Microbiol, 44 (2006), pp. 536-546
[35]
S. Hwang, M. Lim, Y.J. Hong, T. Kim, K.U. Park, J. Song, et al.
Simultaneous detection of Mycobacterium tuberculosis complex and nontuberculous mycobacteria in respiratory specimens.
Tuberculosis (Edinb), 93 (2013), pp. 642-646
[36]
J.E. Clarridge.
Impact of 16S rRNA gene sequence analysis for identification of bacteria on clinical microbiology and infectious diseases.
Clin Microbiol Rev, 17 (2004), pp. 840-862
[37]
M. Garzón, D. Orjuela, O. Naranjo, C. Llerena.
Micobacterias no tuberculosas en Colombia 1995-2003.
Inf Quinc Epidemiol Nac, 10 (2005), pp. 161-176
[38]
M. Casabona, A.R. Bahrmand, J. Bennedsen, V.O. Thomsen, M. Curcio, M. Fauville-Dufaux, et al.
Non-tuberculous mycobacteria: Patterns of isolation. A multi-country retrospective survey.
Int J Tuberc Lung Dis, 8 (2004), pp. 1186-1193
Copyright © 2015. Elsevier España, S.L.U. y Sociedad Española de Enfermedades Infecciosas y Microbiología Clínica
Opciones de artículo
Herramientas
es en pt

¿Es usted profesional sanitario apto para prescribir o dispensar medicamentos?

Are you a health professional able to prescribe or dispense drugs?

Você é um profissional de saúde habilitado a prescrever ou dispensar medicamentos

es en pt
Política de cookies Cookies policy Política de cookies
Utilizamos cookies propias y de terceros para mejorar nuestros servicios y mostrarle publicidad relacionada con sus preferencias mediante el análisis de sus hábitos de navegación. Si continua navegando, consideramos que acepta su uso. Puede cambiar la configuración u obtener más información aquí. To improve our services and products, we use "cookies" (own or third parties authorized) to show advertising related to client preferences through the analyses of navigation customer behavior. Continuing navigation will be considered as acceptance of this use. You can change the settings or obtain more information by clicking here. Utilizamos cookies próprios e de terceiros para melhorar nossos serviços e mostrar publicidade relacionada às suas preferências, analisando seus hábitos de navegação. Se continuar a navegar, consideramos que aceita o seu uso. Você pode alterar a configuração ou obter mais informações aqui.