metricas
covid
Neurología (English Edition) Novel multifunctional nanoliposomes inhibit α-synuclein fibrillization, attenua...
Journal Information
Vol. 39. Issue 4.
Pages 321-328 (May 2024)
Visits
761
Vol. 39. Issue 4.
Pages 321-328 (May 2024)
Original article
Full text access
Novel multifunctional nanoliposomes inhibit α-synuclein fibrillization, attenuate microglial activation, and silence the expression of SNCA gene
Nuevos nanoliposomas multifuncionales inhiben la fibrilización de la α-sinucleína, atenúan la activación de la microglía y silencian la expresión de SNCA
Visits
761
A. Jebalia,
Corresponding author
alijebal2011@gmail.com

Corresponding author.
, M. Rashidib,c, R. Keikhad,e,
Corresponding author
reza.23.md@gmail.com

Corresponding author.
, K. Dalirif,g, T.F. Outeiroh,i,j,k
a Department of Medical Nanotechnology, Faculty of Advanced Sciences and Technology, Pharmaceutical Sciences Branch, Islamic Azad University, Tehran, Iran
b Department of Pharmacology, Faculty of Medicine, Mazandaran University of Medical Sciences, Sari, Iran
c The Health of Plant and Livestock Products Research Center, Mazandaran University of Medical Sciences, Sari, Iran
d Infectious Diseases and Tropical Medicine Research Center, Resistant Tuberculosis Institute, Zahedan University of Medical Sciences, Zahedan, Iran
e Department of Pathology, Faculty of Medicine, Zahedan University of Medical Sciences, Zahedan, Iran
f Child Development Center, Shiraz University of Medical Sciences, Shiraz, Iran
g Institute of Biomedical Sciences, Dehkadeh Salamat Faroq, Faroq, Fars, Iran
h Department of Experimental Neurodegeneration, Center for Biostructural Imaging of Neurodegeneration, University Medical Center Gottingen, Gottingen, Germany
i Max Planck Institute for Experimental Medicine, Göttingen, Germany
j Translational and Clinical Research Institute, Faculty of Medical Sciences, Newcastle University, NE2 4HH, United Kingdom
k Scientific employee with an honorary contract at German Center for Neurodegenerative Diseases (DZNE), Göttingen, Germany
Ver más
This item has received
Article information
Abstract
Full Text
Bibliography
Download PDF
Statistics
Figures (3)
Show moreShow less
Tables (1)
Table 1. The primers used in this study for real-time PCR.
Tables
Abstract
Introduction

The aim of this study was to compare the effect of five types of PEGlated nanoliposomes (PNLs) on α-synuclein (α-syn) fibrillization, attenuation of microglial activation, and silence of the SNCA gene, which encodes α-syn.

Methods

To evaluate the inhibition of α-syn fibrillization, we used standard in vitro assay based on Thioflavin T (ThT) fluorescence. Next, to evaluate the attenuation of microglial activation, the concentration of TNF-a and IL-6 was quantified by ELISA assay in BV2 microglia cells treated with 100nM A53T α-syn and PNLs. In order to determine the silencing of the SNCA, real-time PCR and Western blot analysis was used. Finally, the efficacy of PNLs was confirmed in a transgenic mouse model expressing human α-syn.

Results

ThT assay showed both PNL1 and PNL2 significantly inhibited a-syn fibrillization. ELISA test also showed the production of TNF-a and IL-6 was significantly attenuated when microglial cells treated with PNL1 or PNL2. We also found that SNCA gene, at both mRNA and protein levels, was significantly silenced when BV2 microglia cells were treated with PNL1 or PNL2. Importantly, the efficacy of PNL1 and PNL2 was finally confirmed in vivo in a transgenic mouse model.

Conclusions

In conclusion, the novel multifunctional nanoliposomes tested in our study inhibit α-syn fibrillization, attenuate microglial activation, and silence SNCA gene. Our findings suggest the therapeutic potential of PNL1 and PNL2 for treating synucleinopathies.

Keywords:
Nanoliposomes
Synuclein fibrillization
Microglial activation
SNCA
Resumen
Introducción

El objetivo de este estudio fue comparar el efecto de cinco tipos de nanoliposomas PEGlados (PNL) sobre la fibrilización de la α-sinucleína (α-syn), la atenuación de la activación microglial y el silencio del gen synuclein alpha (SNCA), que codifica α-syn.

Métodos

Para evaluar la inhibición de la fibrilización α-syn, utilizamos un ensayo in vitro estándar basado en la fluorescencia de la tioflavina T (ThT). A continuación, para evaluar la atenuación de la activación microglial, se cuantificó la concentración de factor de necrosis tumoral alpha (TNF-a) e interleucina 6 (IL-6)mediante ensayo ELISA en células de microglía BV2 tratadas con 100nM de α-syn de A53T y PNL. Para determinar el silenciamiento del SNCA, se utilizó reacción en cadena de la polimerasa (PCR) en tiempo real y análisis de Western blot. Finalmente, la eficacia de las PNL se confirmó en un modelo de ratón transgénico que expresa α-syn humana.

Resultados

El ensayo ThT mostró que tanto PNL1 como PNL2 inhibieron significativamente la fibrilización de α-syn. La prueba enzyme-linked immunosorbent assay (ELISA) también mostró que la producción de TNF-a e IL-6 se atenuó significativamente cuando las células microgliales se trataron con PNL1 o PNL2. También encontramos que el gen SNCA, tanto a nivel de ARN mensajero (ARNm) como de proteína, se silenciaba significativamente cuando las células de microglía BV2 se trataban con PNL1 o PNL2. Es importante destacar que la eficacia de PNL1 y PNL2 finalmente se confirmó in vivo en un modelo de ratón transgénico.

Conclusiones

Los nuevos nanoliposomas multifuncionales probados en nuestro estudio inhiben la fibrilización α-syn, atenúan la activación microglial y silencian el gen SNCA. Nuestros hallazgos sugieren el potencial terapéutico de PNL1 y PNL2 para el tratamiento de sinucleinopatías.

Palabras clave:
Nanoliposomas
Fibrilización de sinucleína
Activación microglial
SNCA
Full Text
Introduction

Synucleinopathies are a group of neurodegenerative diseases characterized by the accumulation of α-synuclein (α-syn) in intra-cytoplasmic inclusions in neurons and/or in glial cells.1 Parkinson's disease (PD), dementia with Lewy bodies, and multiple system atrophy are examples of synucleinopathy.2 The physiological role of α-syn in neurodegenerative disorders is unclear and more studies are needed.3 The aggregation process is complex and involves the formation of various types of oligomers, intermediate supramolecular assemblies, and amyloid fibrils.4 The fibrils are linear rods with 5–10nm in diameter and several micrometers in length. Importantly, oligomeric α-syn intermediates, produced at early stages of α-syn aggregation, appear to be the most toxic species.5

A main important problem of synucleinopathies is neuroinflammation, associated with microglial activation.6 Under normal conditions, microglia remove cell debris and foreign biomolecules.7 But the high concentration of α-syn leads to impair of α-syn clearance pathway and induces a pro-inflammatory microglial phenotype.8 The release of pro-inflammatory mediators, such as tumor necrosis factor (TNF-a), interleukin-6 (IL-6), nitric oxide (NO), reactive oxygen species (ROS), and toxic protein aggregates, are the results of microglial activation.9

We posit that, in order to efficiently treat synucleinopathies, α-syn must be targeted at various stages,10 including (1) reducing α-syn synthesis, (2) increasing α-syn degradation, (3) reducing α-syn aggregation, (4) blocking α-syn propagation, (5) activating immune cells against α-syn, and (6) inhibiting neuroinflammation. It should be noted that, although it is difficult to target all pathways, some of them may be targeted by multifunctional nanoparticles. With new advances in medical nanotechnology over the last years, it can be argued that in the near future, it will be possible to treat synucleinopathies using nanoparticles. There are now some data showing that some nanoparticles, i.e. antioxidant nanoparticles,11 zwitterionic nanoliposomes,12 cerium oxide nanoparticles,13 gold nanoparticles,14 and PEGlated nanoliposome 15 are able to inhibit α-syn fibrillization, reduce α-Syn toxicity, and attenuate microglial activation. These nanoparticles may be a part of future therapeutic alternative.

The aim of this study was to compare five types of multifunctional nanoliposomes for their abilities to inhibit α-syn fibrillization, to attenuate microglial activation, and to silence the SNCA gene.

Materials and methodsSynthesis and characterization of nanoliposomes

In this study, 5 types of nanoliposomes were synthesized and characterized, including:

  • 1.

    PEGlated nanoliposomes 1 (PNL1) containing sodium percarbonate (SPC) (Merk, Germany), 1,2-dioleoyl-3-trimethylammonium propane (DOTAP) (Merk, Germany), 1,2-distearoyl-sn-glycero-3-phosphorylethanolamine-polyethylene glycol-2000 (DSPE-PEG-2000) (Merk, Germany), carboxy-PEG (Merk, Germany), omega-3 (Merk, Germany), mannitol (Merk, Germany), 7-hydroxyflavone (Merk), and antisense oligonucleotides (Bioneer, South Korea).

  • 2.

    PEGlated nanoliposomes 2 (PNL2) containing SPC, DOTAP, DSPE-PEG-2000, carboxy-PEG, omega-3, mannitol, and 7-hydroxyflavone.

  • 3.

    PEGlated nanoliposomes 3 (PNL3) containing SPC, DOTAP, DSPE-PEG-2000, carboxy-PEG, omega-3, and mannitol.

  • 4.

    PEGlated nanoliposomes 4 (PNL4) containing SPC, DOTAP, DSPE-PEG-2000, carboxy-PEG, and omega-3.

  • 5.

    PEGlated nanoliposomes 5 (PNL5) containing SPC, DOTAP, DSPE-PEG-2000, and carboxy-PEG.

To synthesize PNLs, reverse-phase evaporation method was used.16 Briefly, SPC, DOTAP, DSPE-PEG-2000, and carboxy-PEG were dissolved in chloroform, and then omega-3, mannitol, 7-hydroxyflavone, and antisense oligonucleotides (5′-CTACATAGAGAACAC-3′) were separately added based on each formulation. The mixture was hardly mixed and homogenized using a probe ultrasound. The pulse was 5s, 2s off, 100% amplitude, and 36joles per pulse. Subsequently, the chloroform was evaporated by a rotary vacuum pump. To hydrate PNLs, PBS was used and their concentrations were adjusted to 1%, 2%, and 4%. Finally, their size distribution was measured by dynamic light scattering (DLS) and their stability was checked until one week at 25°C.

Kinetic of α-syn fibrillization

First, 100μL of PNLs at concentration of 1%, 2%, and 4% was separately incubated with 100μL of 100nM recombinant monomeric α-syn (Sigma-Aldrich) in presence of Thioflavin T (ThT) (Acros Organics) for 60min at 37°C, as previously described.17 The α-syn fibrillization was assessed each 20min at the emission wavelength of 490nm and the excitation wavelength of 450nm

Also, after incubation of PNLs with recombinant monomeric α-syn for 60min, 50μL of each mixture was separately placed on a Butvar-coated copper grid, dried, and then negatively stained by uranyl acetate (1.0%, w/v). Here, a transmission electron microscopy (TEM) (Zeiss EM10, Germany) with an excitation voltage of 100kV was applied to observe and compared the size and morphology of α-syn aggregates.

Microglia activation

BV2 microglia were cultured in DMEM (Gibco) supplemented with 10% fetal bovine serum (Atlanta Biologics) and 1% Penicillin-Streptomycin (Merck, Germany). Then, they were plated at 50,000cells/well in a 96-well plate to adhere overnight. Cells were first treated with 100nM A53T α-syn and then with PNLs at a final concentration of 1%, 2%, and 4%. After 24h, supernatants were collected and assayed for TNF-a and IL-6 by ELISA kit (R&D systems) as previously described.11 Briefly, the high binding ELISA plates (Biomat, Italy) were separately coated with anti-TNF-a IgG and anti-IL-6 IgG (R&D systems) at 1μgmL−1. After washing, 50μL of supernatants was added and incubated for 1h at 37°C. Then, plates were washed and 100μL of secondary antibody (anti-TNF-a IgG and anti-IL-6 IgG (R&D systems)) was added. After incubation and washes, 50μL of 3,3′, 5,5′-tetramethylbenzidine was added and then stopped by a stopping solution. Finally, the absorbance of each well was read by a Spectrophotometer at 450nm (BioTek Industries) and the concentration of TNF-a and IL-6 was calculated using standard curve.

Expression of SNCA

To quantify the expression of SNCA at mRNA level, BV2 microglia cells were cultured in DMEM supplemented with 10% fetal bovine serum and 1% Penicillin-Streptomycin, plated, and treated with PNLs at a final concentration of 1%, 2%, and 4% for 24h. Then, total RNA was extracted by extraction buffer (QIAGEN) and then cDNA was synthesized by cDNA mastermix (Life Technologies). Finally, quantitative real-time PCR was performed on an ABI real-time PCR system using qPCR Master Mix (Life Technologies). The GAPDH was used as a reference gene and the delta-delta CT formula was applied to evaluate the relative expression. The primers used in this study are listed in Table 1.

Table 1.

The primers used in this study for real-time PCR.

  Forward primer sequence (5′3′)a  Reverse primer sequence (5′3′)  Product length (bp) 
SNCA  ATTCGACGACAGTGTGGTGT  GTTTTCTCAGCAGCAGCCAC  102 
GAPDH  GACAGTCAGCCGCATCTTCT  GCGCCCAATACGACCAAATC  104 
a

These primers were designed by NCBI Primer Blast (https://www.ncbi.nlm.nih.gov/tools/primer-blast/).

To quantify the expression of SNCA at the protein level, BV2 microglia cells were cultured in DMEM supplemented with 10% fetal bovine serum and 1% Penicillin-Streptomycin, plated, and treated with PNLs at a final concentration of 1%, 2%, and 4% for 24h. Cell lysates were mixed with Laemlli sample buffer, boiled, and separated on polyacrylamide gel (Thermo Fisher Scientific). After protein transfer to polyvinylidene fluoride membranes (Thermo Fisher Scientific), the blots were probed with the primary antibodies (α-syn (BD Transduction Laboratories) and beta-actin (Millipore)), visualized with secondary antibodies, HRP-conjugated anti-mouse IgG (GE Healthcare), and developed using ECL Prime Western Blotting Detection Reagent. The signals of immunoblots were recorded with a Chemidoc Touch Imaging System. Images of blots were cropped from different parts of the same gel for densitometry analysis.

In vivo assessment

For this part of the study, we used α-syn transgenic mouse model (https://qpsneuro.com/in vivo-services/animal-models/alpha-synuclein-transgenic-mouse-models) to check the efficacy of PNLs. Briefly, transgenic mice were separately treated with 100μL of PNLs 1–5 at a concentration of 4% which taken orally for 5 days. After treatment period, all mice were killed under high dose of anesthesia and then their brains were removed. Then, tissue sections were prepared and fixed. After passing from the serial dilutions of alcohols, the slides were immersed in distilled water and then antigen retrieval was carried out by microwaving in the citric acid buffer. In the next step, 50μL of primary antibody (anti-α-syn IgG (BD Transduction Laboratories)) were added and incubated for 12h. After washing, 50μL of the secondary antibody (FITC-conjugated anti-mouse IgG (GE Healthcare)) were added and incubated for 3h. Finally, the slides were examined by a fluorescent microscopy. The amount of α-syn accumulation was scored and finally normalized to control. To evaluate the neuroinflammation, cerebrospinal fluid (CSF) of mice was used. After treatment of mice, the concentration of TNF-a and IL-6 in CSF was evaluated by ELISA kit (R&D systems) as previously described.11 To evaluate the expression of SNCA, several pieces of brain were cut and hardly crushed by a mechanical pressure. In the next step, the mixture was centrifuged at 5000RPM for 5min and the supernatant is separated for the evaluation of SNCA expression at both mRNA and protein by real-time PCR and Western blot with above mentioned details.

Statistical analysis

Data are presented as mean±SD with 3 independent repeats (n=3) for in vitro experiments and with 5 independent biological repeats for in vivo experiments. Analysis of different study groups was performed using one-way ANOVA with Tukey's post hoc test with p<0.05.

ResultsCharacterization of PNLs

The size distribution of all synthesized PNLs was approximately between 120 and 130nm and all of them were stable during one week at 25°C.

The inhibition of α-syn fibrillization

First we explored the effect of PNLs on α-syn fibrillization using a standard ThT kinetic fibrillization assay. We found that all PNLs shortened the α-syn growth phase, suggesting inhibition of α-syn fibrillization (Fig. 1a–e). Importantly, the endpoint ThT assay showed both PNL1 and PNL2 had significantly less fibrillization when compared with other PNLs (Fig. 1f).

Figure 1.

The effect of PNL1 (a), PNL2 (b), PNL3 (c), PNL4 (d), and PNL5 (e) on α-syn fibrillization by ThT kinetic fibrillization assay. Endpoint ThT results for different concentrations of PNLs (f). TEM images showed the inhibition of fibrillization by PNL1 and PNL2 (g). As seen, very low fibrils were seen when α-syn treated with PNL1 and PNL2 at a concentration of 1%, 2%, and 4% for 60h. The scale bar is 100nm Data are presented as mean±SD; n=3; *p<0.05 when compared with PNL3, PNL4, and PNL5 by one-way ANOVA. Control was α-syn alone without PNLs.

After incubation of PNLs with recombinant monomeric α-syn, they were negatively stained by uranyl acetate and observed by TEM at 100kV. The inhibition of α-syn fibrillization was also seen when monomeric α-syn incubated with PNL1 or PNL2 at concentration of 1%, 2%, and 4%. In other treated groups, we saw high degrees of fibrillization (Fig. 1g).

Attenuation of microglial activation

Activation of microglia leads to the release of inflammatory agents which particularly are harmful for neurons.18 Here, we investigated the effect of PNLs on the production of TNF-a and IL-6 when microglial cells exposed to 100nM α-syn. It was found that the production of TNF-a (Fig. 2a), and IL-6 (Fig. 2b) was significantly decreased when microglial cells were treated with PNL1 or PNL2 at concentrations of 1%, 2%, and 4%.

Figure 2.

Production of TNF-a (a), and IL-6 (b) when microglial cells were first exposed to 100nM α-syn and then treated with PNLs. The expression of SNCA mRNA (c) and SNCA protein (d) when microglial cells were treated with PNLs for 24h. Data are presented as mean±SD; n=3; *p<0.05 when compared with PNL3, PNL4, and PNL5 by one-way ANOVA. Control was microglial cells were exposed to 100nM α-syn and did not treat with PNLs.

Silencing of SNCA expression

The expression of SNCA at the mRNA level was significantly decreased when BV2 microglia cells were treated with PNL1 or PNL2 (Fig. 2c). Also, the expression of SNCA at the protein level was significantly decreased when BV2 microglia cells were treated with PNL1 or PNL2 (Fig. 2d).

In vivo evaluation of the efficacy of PNLs

Based on in vivo experiments, we confirmed the inhibition of α-syn fibrillization, attenuation of microglial activation, and silencing of SNCA in α-syn transgenic mice when treated with PNL1 (Fig. 3a) or PNL2 (Fig. 3b) at concentration of 4%. Importantly, we could not confirm the efficacy of PNL3 (Fig. 3c), PNL4 (Fig. 3d), and PNL5 (Fig. 3e), suggesting these are not good candidates.

Figure 3.

Levels of α-syn fibrillization, TNF-a, IL-6, SNCA mRNA, and SNCA protein in α-syn transgenic mouse model when treated with PNL1 (a), PNL2 (b), PNL3 (c), PNL4 (d), and PNL5 (e) for 5 days. Data are presented as mean±SD; n=5; *p<0.05 when compared with PNL3, PNL4, and PNL5 by one-way ANOVA. Control was α-syn transgenic mouse model which was not treated with PNLs.

Discussion

Finding a chemical compound that can act as a drug for a specific disease is not an easy task and requires many studies and numerous laboratory tests. In the most diseases, several pathways are involved and each pathway must be edited or modified by chemical molecules. In synucleinopathies, several pathways are impaired and their causative agents have not been discovered yet.19 The problem starts with the fact that the expression of SNCA is increased for unknown reasons and then α-syn forms fibrils, which are toxic for nerve cells.20 On the other hand, they cause neuroinflammation at the site of accumulation.21 Based on review literature, various strategies can be considered for the treatment of synucleinopathies.10 First, the overexpression of SNCA must be prevented. The next step is to inhibit aggregation and forming fibril molecules. Another strategy is to decrease neuroinflammation, caused by α-syn molecules and fibrils. With this explanation, it is clear that finding a drug molecule that can affect all of these pathways is very difficult and maybe impossible. Different molecules with different functions can be put inside a nanoliposome and it is possible that different molecules may interact with each other and reduce effects. Contrary, it is also possible that different molecules have a synergistic effect and create a more effective drug.

In this study, we have developed a similar strategy. We synthesized five multifunctional nanoliposomes with different functional molecules. Previous studies had shown that mannitol22 and 7-hydroxyflavone23 have a good ability to inhibit α-syn aggregation. Also, the omega-3 molecule is a powerful anti-inflammatory agent24 and antisense oligonucleotides suppress the expression of SNCA.25 In this study, we found that if all functional molecules are included together, they have a very strong effect and can simultaneously inhibit aggregation of α-syn, silence SNCA gene, and attenuate neuroinflammation. An important point is the difference between PNL1 and PNL2. This study showed that although both PNL1 and PNL2 were significantly effective compared with other PNLs, the efficiency of PNL2 was higher than PNL1. We think that the reason for this phenomenon is that some molecules are incompatible with each other and their accumulation does not cause synergy. It can be said that the addition of antisense oligonucleotides slightly affects the function of other molecules. On the other hand, with a closer look at the results of PNL4 and PNL3, we will find an interesting phenomenon. We found that although these nanoliposomes have omega-3 and/or mannitol, they did not lead to inhibit α-syn aggregation or attenuate neuroinflammation, indicating that the presence of all compounds is necessary for maximum effect. Regarding PNL5, it should be noted that although this nanoliposome did not have any functional molecules, it could slightly inhibit α-syn aggregation, neuroinflammation, and SNCA expression.

Zhao et al. showed that antioxidant nanoparticles inhibit α-syn fibrillization and attenuate microglial activation.11 This study is an example that showed us a nanotherapeutic candidate can target both protein aggregation and neuroinflammation in neurodegenerative diseases. Zwitterionic nanoliposomes were also used to inhibit neurotoxic α-syn aggregation in PD. The effect of neutral (zwitterionic) nanoliposomes, supplemented with cholesterol and decorated with PEG, on α-syn aggregation and neurotoxicity was reported by Aliakbari et al., 12 cerium oxide nanoparticles13 and gold nanoparticles14 also could inhibit α-syn aggregation. Previously, Jebali et al. also showed that PEGlated nanoliposome could attenuate inflammatory response in mice model of multiple sclerosis.15

Conclusion

Taken together, this study showed that PNL1 and PNL2 could significantly inhibit α-syn fibrillization, attenuate microglial activation, and silence SNCA gene, when compared with other PNLs. We hypothesize that, in the future, clinical trials using PNL1 and PNL2 should be considered for the treatment of synucleinopathies.

Ethical approval

All experiments were performed under the guidelines of the National Institute of Health, the provisions of the Declaration of Helsinki, and the National Ethics Committee of Medical Science.

Funding

The main parts of the study were financially supported by Zahedan University of Medical Sciences, Zahedan, Iran (Grant number: 9936 and 9937). Also, some parts were financed by the internal budget of the authors.

Competing interests

The authors have no conflicts of interest to declare.

Acknowledgements

We thank the Laboratory staff of Faculty of Advanced Sciences and Technology, Pharmaceutical Sciences Branch, Islamic Azad University, Tehran, Iran, and Zahedan University of Medical Sciences, Zahedan, Iran.

References
[1]
S.O. Hoppe, G. Uzunoğlu, C. Nussbaum-Krammer.
α-Synuclein strains: does amyloid conformation explain the heterogeneity of synucleinopathies?.
Biomolecules, 11 (2021), pp. 931
[2]
T.F. Outeiro.
Emerging concepts in synucleinopathies.
Springer, (2021),
[3]
I.V. Murray, V.M.-Y. Lee, J.Q. Trojanowski.
Synucleinopathies: a pathological and molecular review.
Clin Neurosci Res, 1 (2001), pp. 445-455
[4]
V.N. Uversky.
Neuropathology, biochemistry, and biophysics of α-synuclein aggregation.
J Neurochem, 103 (2007), pp. 17-37
[5]
R. Kumar, S. Das, G.M. Mohite, S.K. Rout, S. Halder, N.N. Jha, et al.
Cytotoxic oligomers and fibrils trapped in a gel-like state of α-synuclein assemblies.
Angew Chem, 130 (2018), pp. 5360-5364
[6]
J. Rogers, D. Mastroeni, B. Leonard, J. Joyce, A. Grover.
Neuroinflammation in Alzheimer's disease and Parkinson's disease: are microglia pathogenic in either disorder?.
Int Rev Neurobiol, 82 (2007), pp. 235-246
[7]
S. Theodore, S. Cao, P.J. McLean, D.G. Standaert.
Targeted overexpression of human α-synuclein triggers microglial activation and an adaptive immune response in a mouse model of Parkinson disease.
J Neuropathol Exp Neurol, 67 (2008), pp. 1149-1158
[8]
C.L. Ugalde, D.I. Finkelstein, V.A. Lawson, A.F. Hill.
Pathogenic mechanisms of prion protein, amyloid β and α synuclein misfolding: the prion concept and neurotoxicity of protein oligomers.
J Neurochem, 139 (2016), pp. 162-180
[9]
M.A. Muñoz-Fernández, M. Fresno.
The role of tumour necrosis factor, interleukin 6, interferon-γ and inducible nitric oxide synthase in the development and pathology of the nervous system.
Prog Neurobiol, 56 (1998), pp. 307-340
[10]
Y.C. Wong, D. Krainc.
α-Synuclein toxicity in neurodegeneration: mechanism and therapeutic strategies.
Nat Med, 23 (2017), pp. 1-13
[11]
N. Zhao, X. Yang, H.R. Calvelli, Y. Cao, N.L. Francis, R.A. Chmielowski, et al.
Antioxidant nanoparticles for concerted inhibition of α-synuclein fibrillization, and attenuation of microglial intracellular aggregation and activation.
Front Bioeng Biotechnol, 8 (2020), pp. 112
[12]
F. Aliakbari, H. Mohammad-Beigi, N. Rezaei-Ghaleh, S. Becker, F.D. Esmatabad, H.A.E. Seyedi, et al.
The potential of zwitterionic nanoliposomes against neurotoxic alpha-synuclein aggregates in Parkinson's disease.
Nanoscale, 10 (2018), pp. 9174-9185
[13]
R. Ruotolo, G. De Giorgio, I. Minato, M.G. Bianchi, O. Bussolati, N. Marmiroli.
Cerium oxide nanoparticles rescue α-synuclein-induced toxicity in a yeast model of Parkinson's disease.
Nanomaterials, 10 (2020), pp. 235
[14]
Y.D. Álvarez, J.A. Fauerbach, Pellegrotti JsV, T.M. Jovin, E.A. Jares-Erijman, F.D. Stefani.
Influence of gold nanoparticles on the kinetics of α-synuclein aggregation.
Nano Lett, 13 (2013), pp. 6156-6163
[15]
A. Jebali, M.N. Karimabad, Z. Ahmadi, H. Khorramdel, A. Kaeidi, M. Mirzaei, et al.
Attenuation of inflammatory response in the EAE model by PEGlated nanoliposome of pistachio oils.
J Neuroimmunol, 347 (2020), pp. 577352
[16]
R. Cortesi.
Preparation of liposomes by reverse-phase evaporation using alternative organic solvents.
J Microencapsulation, 16 (1999), pp. 251-256
[17]
H. Vicente Miranda, É.M. Szegő, L.M. Oliveira, C. Breda, E. Darendelioglu, R.M. de Oliveira, et al.
Glycation potentiates α-synuclein-associated neurodegeneration in synucleinopathies.
Brain, 140 (2017), pp. 1399-1419
[18]
M.E. Lull, M.L. Block.
Microglial activation and chronic neurodegeneration.
Neurotherapeutics, 7 (2010), pp. 354-365
[19]
J.E. Duda, V.M.Y. Lee, J.Q. Trojanowski.
Neuropathology of synuclein aggregates: new insights into mechanisms of neurodegenerative diseases.
[20]
B. Winner, R. Jappelli, S.K. Maji, P.A. Desplats, L. Boyer, S. Aigner, et al.
In vivo demonstration that α-synuclein oligomers are toxic.
Proc Natl Acad Sci, 108 (2011), pp. 4194-4199
[21]
A. Gustot, J.I. Gallea, R. Sarroukh, M.S. Celej, J.-M. Ruysschaert, V. Raussens.
Amyloid fibrils are the molecular trigger of inflammation in Parkinson's disease.
Biochem J, 471 (2015), pp. 323-333
[22]
R. Shaltiel-Karyo, M. Frenkel-Pinter, E. Rockenstein, C. Patrick, M. Levy-Sakin, A. Schiller, et al.
A blood–brain barrier (BBB) disrupter is also a potent α-synuclein (α-syn) aggregation inhibitor: a novel dual mechanism of mannitol for the treatment of Parkinson disease (PD).
J Biol Chem, 288 (2013), pp. 17579-17588
[23]
R. Staats, T.C. Michaels, P. Flagmeier, S. Chia, R.I. Horne, J. Habchi, et al.
Screening of small molecules using the inhibition of oligomer formation in α-synuclein aggregation as a selection parameter.
Commun Chem, 3 (2020), pp. 1-9
[24]
J. Giacobbe, B. Benoiton, P. Zunszain, C.M. Pariante, A. Borsini.
The anti-inflammatory role of omega-3 polyunsaturated fatty acids metabolites in pre-clinical models of psychiatric, neurodegenerative and neurological disorders.
Front Psychiatry, 11 (2020), pp. 122
[25]
T. Uehara, C.-J. Choong, M. Nakamori, H. Hayakawa, K. Nishiyama, Y. Kasahara, et al.
Amido-bridged nucleic acid (AmNA)-modified antisense oligonucleotides targeting α-synuclein as a novel therapy for Parkinson's disease.
Copyright © 2021. Sociedad Española de Neurología
Download PDF