Buscar en
Infectio
Toda la web
Inicio Infectio Factores de riesgo para infección o colonización por Acinetobacter baumannii r...
Información de la revista
Vol. 20. Núm. 4.
Páginas 238-249 (Octubre - Diciembre 2016)
Compartir
Compartir
Descargar PDF
Más opciones de artículo
Visitas
4059
Vol. 20. Núm. 4.
Páginas 238-249 (Octubre - Diciembre 2016)
Original
DOI: 10.1016/j.infect.2015.11.003
Open Access
Factores de riesgo para infección o colonización por Acinetobacter baumannii resistente a carbapenémicos en pacientes adultos hospitalizados en Unidades de Cuidado Intensivo, Bogotá, Colombia
Risk factors for colonisation or infection by Acinetobacter baumannii resistant to carbapenems in adult patients hospitalised in Intensive Care Units in Bogota, Colombia
Visitas
...
Carlos Humberto Saavedra-Trujilloa,c,
Autor para correspondencia
chsaavedrat@unal.edu.co

Autor para correspondencia.
, Gerson Arias-Leóna, Sandra Milena Gualtero-Trujilloa, Aura Lucía Lealb,c, Sandra Yamile Saavedra-Rojasb, Martha Isabel Murciab
a Departamento de Medicina, Facultad de Medicina, Universidad Nacional de Colombia, Bogotá, D.C., Colombia
b Departamento de Microbiología, Facultad de Medicina, Universidad Nacional de Colombia sede Bogotá, Bogotá, D.C., Colombia
c GREBO, Bogotá, D.C., Colombia
Información del artículo
Resumen
Texto completo
Bibliografía
Descargar PDF
Estadísticas
Figuras (1)
Tablas (7)
Tabla 1. Secuencia de iniciadores utilizados en los ensayos de PCR
Tabla 2. Datos clínicos y perfiles de EGCP de los aislamientos de A. baumannii analizados
Tabla 3. Variables demográficas de tipo categórico de pacientes con infección o colonización por A. baumannii resistente a carbapenémicos en 13 UCI de Bogotá (Colombia), entre abril de 2005 y abril de 2006
Tabla 4. Variables demográficas de tipo continuo de pacientes con infección o colonización por A. baumannii resistente a carbapenémicos en 13 UCI de Bogotá (Colombia), entre abril de 2005 y abril de 2006
Tabla 5. Resultado de análisis multivariado para factores de riesgo de desarrollar resistencia asociados a infección o colonización por A. baumannii resistente a carbapenémicos en 13 UCI de Bogotá (Colombia), entre abril de 2005 y abril de 2006
Tabla 6. Sensibilidad antimicrobiana de aislamientos de A. baumannii resistentes a carbapenémicos
Tabla 7. Distribución de los aislamientos del clon Ab22 en las instituciones a través del tiempo del estudio
Mostrar másMostrar menos
Resumen
Objetivo

Describir factores de riesgo asociados a infección o colonización por Acinetobacter baumannii resistente a carbapenémicos en adultos hospitalizados en unidades de cuidado intensivo (UCI) de 13 instituciones de Bogotá.

Materiales y métodos

Estudio prospectivo de casos y controles. El diagnóstico de estos fue infección o colonización, con aislamientos de A. baumannii resistente a carbapenémicos y los controles de pacientes con aislamientos de A. baumannii sensibles a carbapenémico. Se incluyó a 165 personas y se hizo un aislamiento por paciente. A aquellos que presentaban A. baumannii resistente a carbapenémicos se les evaluó la sensibilidad y a todos los que presentaron A. baumannii (resistente o sensible a carbapenémicos) se les realizó detección de carbapenemasas por PCR y electroforesis en gel de campo pulsado.

Resultados

Del total de aislamientos, 30 fueron A. baumannii sensible a carbapenémicos y 135 a A. baumannii resistente a carbapenémicos (83,7% fueron multirresistentes y 99% sensibles a polimixina). Todos los A. baumannii fueron positivos para OXA-51. De los A. baumannii resistentes a carbapenémicos, 129 fueron positivos para OXA-23, uno para OXA-72 y los restantes únicamente para OXA-51. Por electroforesis en gel de campo pulsado se determinaron 46 genotipos (12 clones y 34 perfiles únicos); el más grande fue Ab22 (n=89). Del total de aislamientos, 117 correspondieron a infección y 48 a colonización. En el análisis multivariado, los factores relacionados con ABRC fueron: hospitalización previa (OR 11,9; IC 95%: 1,59-89), exposición a carbapenémicos por más de 3 días (OR 10,36; IC 95%: 1,73–61,95) y presencia de infección o colonización por genotipo Ab22 (OR 449; IC 95%: 25-798).

Discusión

A. baumannii es de difícil tratamiento y erradicación del entorno hospitalario. Las medidas de prevención de infección cruzada y uso prudente de antibióticos son fundamentales para prevenir la infección por gérmenes multirresistentes en hospitales. Se identificaron 3 factores de riesgo, 2 potencialmente asociados a infección cruzada, hospitalización previa y un clon predominante, y otro relacionado con uso aumentado de carbapenémicos.

Conclusión

Se identificaron 3 factores de riesgo, 2 potencialmente asociados a infección cruzada, hospitalización previa y un clon predominante, y otro relacionado con uso aumentado de carbapenémicos por más de 3 días.

Palabras clave:
Acinetobacter baumannii
Carbapenémicos
Factores de Riesgo
Terapia intensiva
Multiresistencia
Unidades de cuidados intensivos
Abstract
Objective

To describe the risk factors for colonisation or infection by carbapenem-resistant Acinetobacter baumannii in adults hospitalised in the ICU of 13 hospitals of Bogota.

Materials and methods

A prospective, case control study. The case group was defined as having infection with carbapenem-resistant A. baumannii and the control group was defined as having infection with carbapenem-sensitive A. baumannii. We included 165 patients, one isolate per patient. Sensitivity was assessed in carbapenem-resistant A. baumannii and carbapenemase detection by PCR and pulsed field gel electrophoresis was performed on all patients.

Results

Thirty isolates were carbapenem-sensitive A. baumannii and 135 were carbapenem-resistant A. baumannii (83.7% were multiresistant and 99% were sensitive to polymyxin). All isolates were positive to OXA-51. Of the carbapenem-resistant A .baumannii, 129 were positive to OXA 23, one to OXA-72 and the rest were positive to OXA-51. Using PFGE, 46 genotypes were identified, and the most common was Ab22 (n=89). A total of 117 isolates were classified as infection and 48 as colonisation. Multivariate analysis determined the risk factors for carbapenem resistant A. baumannii to be: Previous hospitalisation (OR 11.9, 95% CI: 1.59 to 89), exposure to carbapenems for more than 3 days (OR 10.36, 95% CI: 1.73 to 61.95) and the presence of infection or colonisation by the Ab22 genotype (OR 449, 95% CI: 25 to 798).

Discussion

A. baumannii is difficult to treat and eradicate from the hospital environment. This study identified 3 risk factors, 2 potentially associated with cross-infection (previous hospitalisation and the presence of a predominant clone) and the third was related to the use of carbapenems for more than 3 days.

Conclusion

This study identified 3 risk factors, 2 potentially associated to cross-infection (previous hospitalisation and the presence of a predominant clone) and the third was related to the use of carbapenems for more than 3 days.

Keywords:
Acinetobacter baumannii
Carbapenems
Risk factor's
Intensive therapy
Multidrug resistance
Intensive care units Gracias
Texto completo
Introducción

Acinetobacter baumannii es un patógeno hospitalario, relacionado ampliamente con infecciones asociadas a la atención en salud (IAAS)1, que afecta con predilección a pacientes críticamente enfermos1–3, de muy difícil control por su capacidad para sobrevivir en condiciones ambientales extremas y posibilidad de transmisión cruzada y aérea2,4. Adicionalmente A. baumannii se ha diseminado rápidamente en el ambiente hospitalario por su capacidad de adquirir resistencia a múltiples antibióticos, en particular a los carbapenémicos, cuya resistencia es mediada por carbapenemasas, principalmente de clase D (oxacilinasas) y, con menos frecuencia, de clase B o metalobetalactamasas (MBL)2–3, así como a desinfectantes en relación con bombas de expulsión tipo amv A5. El riesgo de mortalidad entre los pacientes que se infectan por este agente1,2 es muy alto: en un metaanálisis reciente se describe un 33%, con un rango de 8 a 40% y riesgo incrementado de mortalidad de 2,49 de los pacientes infectados por A. baumannii resistentes a carbapenémicos1 (ABRC).

En Bogotá, la resistencia a A. baumannii en Unidades de Cuidado Intensivo (UCI) fue ≥50% para imipenem y >55% para meropenem, entre los años 2005 y 20076. A. baumannii es epidémico y puede pasar a ser endémico7; el mayor riesgo se observa en las UCI, donde la mortalidad atribuible está entre el 20 y el 65%8. En un estudio de Colombia, se observó que la resistencia en esta población se asoció con incremento de un 60% en los costos de hospitalización9. En Latinoamérica, la información es escasa; por ello, es difícil ponderar el impacto de diferentes factores de riesgo en el desarrollo de resistencia. El propósito de este estudio es describir los factores de riesgo asociados a infección o colonización por ABRC, en adultos hospitalizados en UCI de 13 instituciones de Bogotá.

MetodologíaTipo de estudio y población

Estudio multicéntrico y prospectivo de casos y controles, en pacientes adultos hospitalizados en UCI de 13 instituciones de Bogotá (H1 a H13, nombradas aleatoriamente) y protocolo con previa aprobación del Comité de Ética. El criterio de inclusión fue que los pacientes tuvieran más de 18 años y que estuvieran hospitalizados en UCI con cultivo de AB. Como el objetivo fue establecer los factores de riesgo para infección o colonización por ABRC, solo se trabajó con pacientes diagnosticados con infección o colonización con aislamiento de este. Para confirmarlo, se realizó una prueba de referencia. Se incluyó a los pacientes que, con el primer aislamiento, presentaran A. baumannii sensible a carbapenémicos (ABSC). Se excluyó a pacientes con aislamiento concomitante de microorganismos diferentes.

El estudio se realizó entre abril de 2005 y el mismo mes de 2006. No fueron incluidos pacientes con aislamientos de ABRC o ABSR identificados antes del inicio del estudio. El emparejamiento se realizó a partir de pacientes hospitalizados en UCI por más de 48 h y hasta 7 días después de su traslado al hogar, al momento de la toma de la muestra con la que se identificó un aislamiento de AB. Se diseñó con error alfa inferior a 5% y beta inferior a 20%, hipótesis de no asociación de factores de riesgo para aislamientos de AB, diferencia de exposición entre casos y controles de 20% y pérdidas de 10%, con relación caso-control 1:1. En total, se tuvieron en cuenta 134 casos10.

Recolección y manejo de la información

Variables analizadas: género, edad, estancia hospitalaria, diagnósticos de ingreso a UCI, origen de la muestra, foco de infección, presencia y duración de dispositivos invasivos, enfermedad quirúrgica, antibióticos previos al cultivo, duración de tratamiento y dosis, puntaje APACHE II al ingreso a UCI, gravedad de sepsis —según criterios de Bone11— y presencia de enfermedades médicas asociadas. Se conformó un comité de expertos encargados de aplicar a cada caso criterios de IAAS según CDC11 y de definir el aislamiento como infectante o colonizante, y si el inicio antimicrobiano empírico fue apropiado, según diagnóstico infeccioso y perfil de sensibilidad.

Caracterización fenotípica

Se analizó un aislamiento por paciente. La identificación se realizó con API20NE (bioMérieux). En los aislamientos de ABRC, se evaluó sensibilidad antimicrobiana por concentración mínima inhibitoria (CMI) a través de E-Test (AB biodisk) para aztreonam, amikacina, ceftazidima, ceftriaxona, cefepima, ciprofloxacina, imipenem, meropenem, piperacilina-tazobactam, ampicilina-sulbactam, cefoperazona-sulbactam y colistina. El procedimiento y la interpretación de resultados se realizó de acuerdo con las instrucciones del fabricante. La presencia de carbapenemasas MBL se determinó por E-test usando la tira imipenem/imipenem+EDTA (IP/IPI). Los aislamientos con resultado de CMI IP/IPI ≥8 fueron considerados positivos. La multirresistencia se definió como resistencia a 3 o más clases de antibióticos.

Detección de genes codificantes de carbapenemasas

El ADN de los aislamientos se obtuvo por lisis celular a partir de colonias bacterianas frescas de un cultivo en agar BHI, suspendidas en 100 uL de agua destilada estéril y llevadas a calentamiento hasta ebullición por 10 min. La detección de genes codificantes de carbapenemasas se realizó a través de reacción en cadena de la polimerasa (PCR). Para genes codificantes de carbapenemasas oxacilinasas se usó un ensayo de PCR múltiple convencional para blaOXA-23, blaOXA-24, blaOXA-51 y blaOXA-5812 (tabla 1) y para carbapenemasas MBL se usó PCR simple convencional para los genes blaVIM y blaIMP13 (tabla 1). Se utilizaron mezclas de reacción que contenían: solución tampón de PCR 1X, 3mM de MgSO4 (PCR múltiplex de OXAs) y 2mM de MgSO4 (PCR simple), 0,2mM de dNTPs, 0,5μM de cada iniciador excepto para blaIMP para el cual se utilizó 1μM, y 1 U/μL de Taq AccuPrime (Invitrogen®) para la PCR múltiplex y 0,5 U/μL de Taq para la PCR simple. Las condiciones de amplificación usadas se estandarizaron en el laboratorio y fueron desnaturalización inicial de 95°C por 5 min, 35 ciclos de 95°C por 45 s, anillamiento de 53°C para blaIMP y 56°C para blaVIM y la PCR múltiplex de OXAs por un minuto, 72°C por un minuto y una extensión final a 72°C por 7 min. Las reacciones de PCR se realizaron en el termociclador iCycler® de Bio-Rad. Los productos de amplificación se visualizaron en geles de agarosa al 1,2%, teñidos con bromuro de etidio (0,5μg/mL).

Tabla 1.

Secuencia de iniciadores utilizados en los ensayos de PCR

Nombre  Secuencia  Tamaño del producto  Referencia 
OXA-23-like F  5′ GAT CGG ATT GGA GAA CCAGA 3′  501pb12
OXA-23-like R  5′ ATT TCT GAC CGC ATT TCC AT 3′ 
OXA-24- like F  5′GGT TAG TTG GCC CCC TTA AA 3′  246bp
OXA-24- like R  5′ AGT TGA GCG AAA AGG GGA TT 3′ 
OXA-51- like F  5′ TAA TGC TTT GAT CGG CCT TG 3′  353bp
OXA-51- like R  5′ TGG ATT GCA CTT CAT CTT GG 3′ 
OXA-58- like F  5′ AAG TAT TGG GGC TTG TGC TG 3′  599pb
OXA-58- like R  5′ CCC CTCTGCGCTCTACATAC 3′ 
IMPgen-F1  5′ GAATAG(A/G)(A/G)TGGCTTAA(C/T)TCTC 3′  188pb13
IMPgen-R1  5′ CCAAAC(C/T)ACTA(G/C)GTTATC 3′ 
VIMgen-F2  5′ GTTTGGTCGCATATCGCAAC 3′  382pb
VIMgen-R2  5′ AATGCGCAGCACCAGGATAG 3′ 
Secuenciación de ADN

Los productos de amplificación obtenidos fueron purificados con el estuche comercial PureLink PCR (Invitrogen®) y enviados a secuenciación en ambas cadenas con los iniciadores descritos (tabla 1). Las amplímeros fueron secuenciados en el equipo MegaBace DNA Analysis System (Amersham®) (servicio de secuenciación BioMol Ltda). Las secuencias de nucleótidos obtenidas se editaron con el software Molecular Evolutionary Genetics Analysis (MEGA version 4.0) y la identidad de las secuencias se evaluó comparándolas con las secuencias de ADN almacenadas en las bases de datos del GenBank disponibles en el sitio web BLASTN (https://blast.ncbi.nlm.nih.gov/Blast.cgi).

Electroforesis en gel de campo pulsado

La tipificación se realizó con electroforesis en gel de campo pulsado (EGCP), el ADN fue digerido con la enzima de restricción ApaI (Promega®) y separado en el equipo CHEFDRIII (BioRad®), usando las condiciones previamente descritas por Seifert et al.14. Los patrones electroforéticos se analizaron con el software Fingerprinting II (Bio-Rad®). El coeficiente de DICE se usó para calcular las similitudes de los patrones, y para la construcción del dendrograma se usó el algoritmo Unweight Pair-Group Meted with Arithmetic Averages (UPGMA), con una tolerancia de 1,5% y una optimización de 1%. Los aislamientos con similitud ≥85% fueron considerados del mismo genotipo (relacionados clonalmente).

Análisis estadístico

Se realizó estadística descriptiva, análisis bivariado de diferencia de proporciones (X2), prueba de Fisher y rangos logarítmicos, según la necesidad. Se hizo un análisis multivariado de regresión logística. Para el modelo de regresión, se estableció como variable de desenlace la resistencia a carbapenémicos, definida según resultado de E-test a imipenem y meropenem. Las variables de predicción serán incluidas a partir de los resultados del análisis bivariado, con probabilidad de azar inferior a 20% (según recomendación de Kleinbaun).

Para controlar la confusión, se incluyeron dentro del modelo variables sin significación estadística, que, sin embargo, han sido reconocidas como fuente de confusión en diferentes publicaciones. El resultado final del análisis de regresión logística fue validado por 2 métodos diferentes: el de residuos de Shoenfeld y la prueba de bondad de ajuste. Se usó el programa STATA 8.0 (licenciado a la Universidad Nacional de Colombia).

ResultadosIncidencia de infección o colonización

El 1,47% de los pacientes en UCI se infectaron por AB. Un total de 115 correspondieron a IAAS, 2 a infección extrainstitucional y 48 a colonización, distribuidos así: 34 de 153 resultaron ser resistentes y 14 de 30, sensibles. Una institución presentó la mayor frecuencia de aislamientos, con 16%, y otra no presentó ningún aislamiento. La resistencia fue superior al 60% en la mayoría de las instituciones; una tercera institución no presentó resistencia en sus aislamientos (tabla 1). Se concluyó, a partir del seguimiento al AB, que este se presenta en brotes temporales y recurrentes.

Se identificaron desde 3 aislamientos, en una institución, hasta 52, en otra, con reconocimiento de 3 brotes y manifestaciones de endemicidad. Cerca del 75% de los pacientes habían estado hospitalizados 90 días antes. Las principales causas de ingreso a UCI fueron el compromiso del sistema nervioso central (17%) y enfermedades abdominales (15%). Un total de 41 pacientes presentaron enfermedades concomitantes, como diabetes mellitus (12%) y enfermedad pulmonar crónica (11%). Además, el 90% tuvo ventilación mecánica.

Los antibióticos más utilizados previamente en UCI fueron: cefepima 400 DDD, piperacilina-tazobactam 299 DDD, meropenem 227 DDD, ceftriaxona 217 DDD e imipenem 178 DDD. La estancia hospitalaria fue 35 días (IC 95%: 31–40) y los pacientes estuvieron hospitalizados en UCI cerca de 9 días (IC 95%: 7,3–11). Los aislamientos fueron recuperados principalmente de sangre (22,1%; n=37) y tracto respiratorio (18,5%; n=31) (tabla 2). La mediana de edad fue 51 años (IC 95%; 47–58), con APACHE entre 15 y 16; 131 pacientes estuvieron previamente hospitalizados en otros servicios antes del aislamiento de AB.

Tabla 2.

Datos clínicos y perfiles de EGCP de los aislamientos de A. baumannii analizados

Hospital  N.° de aislamientosMuestras clínicasPerfiles EGCP
  ABRC  ABSC  Tracto respiratorio  Herida  Catéter  Sangre  Fluido estéril  Abscesos  Otras  Colonización  Genogrupos (n.° de cepas)  Perfil individual 
H1  Ab22 (6)  Ab6
Ab3 
H2  Ab4 (2)  Ab5
Ab8 
H3  Ab22 (4)  Ab25
Ab9 
H4  14  Ab22 (1)
Ab12 (13) 
Ab21
Ab28 
H5  Ab22 (1)
Ab41 (2) 
H6  48  11  11  18  Ab22 (48)  Ab2
Ab31
Ab45
Ab15 
H7  15  Ab13 (3)
Ab22 (10) 
Ab27
Ab29
Ab30
Ab34
Ab46 
Hospital  N.° de aislamientosMuestras clínicasPerfiles EGCP
  ABRC  ABSC  Tracto respiratorio  Herida  Catéter  Sangre  Fluido estéril  Abscesos  Otras  Colonización  Genogrupos (n.° de cepas)  Perfil individual 
H8  16  Ab7 (2)
Ab16 (4)
Ab17 (3)
Ab22 (3)
Ab44 (3) 
Ab33
Ab35
Ab37
Ab38
Ab39
Ab42 
H9  10 
Ab22 (2)
Ab23 (2)
Ab24 (6)
 
Ab43
Ab10 
H10 
Ab22 (3)
Ab40 (2)
 
Ab18 
H11  Ab22 (6) 
Ab1
Ab26
 
H12  Ab22 (2)  Ab11
Ab19
Ab20
Ab32
Ab36 
H13  Ab22 (3)  Ab14 

ABRC: Acinetobacter baumannii resistente a carbapenémicos; ABSC: Acinetobacter baumannii sensible a carbapenémicos; EGCP: electroforesis en gel de campo pulsado.

El uso de antibióticos en las diferentes instituciones no se sigue comúnmente por servicios. Se encontró una alta frecuencia de uso de carbapenémicos en las instituciones 7, 8 y 9; el más usado es meropenem. De los antibióticos evaluados, el más utilizado es cefepime, seguido de piperacilina, tazobactam y ceftriaxona (4a).

En el análisis bivariado inicial, los factores asociados con identificación de ABRC fueron: catéter venoso central (CVC) y días con CVC, presencia de sonda vesical (SV) y días con SV, días desde la primera cirugía, estancia hospitalaria previa, hospitalización previa, ingreso por cirugía general, exposición previa a carbapenémicos y cefalosporinas de tercera generación, por más de 3 días, e identificación del genotipo Ab22 (tablas 3 y 4). Las variables que permanecieron en el análisis de regresión logística fueron: exposición a carbapenémicos por más de 3 días, OR de 10,4 (IC 95%: 1,7–62) hospitalización previa, OR de 7,99 (IC 95%: 1,3–47,9), tiempo de ventilación mecánica en días, OR de 16,4 (IC 95%: 1,9–138), aislamiento de Ab22, OR 449 (IC 95%: 25–798), e IAAS, OR de 14,12 (IC 95%: 2,4–82,2) (tabla 5).

Tabla 3.

Variables demográficas de tipo categórico de pacientes con infección o colonización por A. baumannii resistente a carbapenémicos en 13 UCI de Bogotá (Colombia), entre abril de 2005 y abril de 2006

Variables categóricas  A. baumannii sensible  A. baumannii resistente  OR  IC 95%
Hombres  62,86  58,33  1,21  0,528  2,85  0,628 
Hospitalización previa  54,29  82,58  3,99  1,64  10  0,00 
Servicio de ingreso
Urgencias  28  2,80  0,83  9,5  0,097 
Medicina interna  16  1,60  0,45  5,6  0,46 
Cirugía general  49  3,50  1,17  10,5  0,02 
UCI  0,50  0,03  0,9  0,64 
Ortopedia  0,67  0,12  3,6  0,64 
Otros servicios  11  1,37  0,35  5,4  0,65 
Foco de infección
Colonización  14  35 
Torrente sanguíneo  16  0,66  0,22  2,01  0,47 
Intraabdominal  23  1,66  0,47  5,84  0,43 
Vías aéreas bajas  23  0,43  0,06  2,93  0,39 
Infección del sitio operatorio  0,29  0,06  1,35  0,12 
Diagnóstico infeccioso
Colonización  14  35 
Neumonía nosocomial  10  27  0,26  0,05  1,30  0,10 
Bacteriemia secundaria  24  0,76  0,12  5,01  0,78 
Sepsis  12  1,14  0,09  1,40  0,92 
Peritonitis    0,00  2,17  0,14 
Infección del sitio operatorio  0,57  0,04  7,44  0,67 
Bacteriemia por catéter  0,48  0,04  6,35  0,58 
Enfermedad de base  15  54  0,92  0,41  2,25  0,84 
Anemia  16  1,03  0,40  2,64  0,94 
Cáncer  12  1,07  0,27  6,24  0,92 
Desnutrición crónica  0,92  0,17  9,53  0,92 
Diabetes  18  1,68  0,45  0,95  0,42 
EPOC  13  0,53  0,17  1,85  0,22 
Infección VIH/sida  1,06  0,10  5,38  0,95 
Nefropatía crónica  0,23  8,83  0,55 
Inmunosupresión  0,14  0,79 
Antibiótico adecuado  12  34  0,37  0,12  1,09  0,04 
Dispositivos invasivos
Catéter central corta duración  31  128  4,13  0,72  2,32  0,04 
Línea arterial  23  1,27  0,42  4,62  0,66 
Gastrostomía  0,13  0,01  0,96  0,01 
Catéter hemodiálisis  0,31  0,06  1,65  0,07 
Nutrición parenteral  10  39  1,05  0,44  2,69  0,91 
Sonda vesical  27  122  3,56  1,11  1,08  0,00 
Traqueostomía  19  0,81  0,28  2,72  0,69 
Ventilación mecánica  29  122  2,52  0,69  8,37  0,09 
Tubo orotraqueal  29  122  2,52  0,69  8,37  0,09 
Tubo de toráx  24  1,07  0,38  3,51  0,89 
Drenes  14  0,92  0,26  4,11  0,89 
Procedimientos quirúrgicos  25  106  1,63  0,62  4,06  0,26 
Abdominal  11  61  1,87  0,80  4,59  0,12 
Neurocirugía  16  0,67  0,22  2,27  0,43 
Toráx  15  0,99  0,29  4,41  0,99 
Exposición previa a antibióticos
Aminoglucósidos  29  1,88  0,69  5,98  0,19 
Carbapenémicos  56  5,71  1,85  2,33  0,00 
Cefalosporinas de 1.ª y 2.ª  30  0,77  0,24  2,93  0,64 
Cefalosporinas de 3.ª  33  4,24  0,97  3,85  0,04 
Cefepima  10  25  0,74  0,30  1,92  0,47 
Ampicilina-sulbactam  10  30  0,74  0,30  1,94  0,49 
Ciprofloxacina  28  0,60  0,20  2,06  0,33 
Piperacilina-tazobactam  26  1,90  0,59  8,04  2,57 
Metronidazol  1,06  0,20  1,08  0,94 
Otros antibióticos  11  3,09  0,42  1,37  0,26 

EPOC: enfermedad pulmonar obstructiva crónica; IC: intervalo de confianza; OR: odds ratio; UCI: Unidad de cuidado intensivo.

Tabla 4.

Variables demográficas de tipo continuo de pacientes con infección o colonización por A. baumannii resistente a carbapenémicos en 13 UCI de Bogotá (Colombia), entre abril de 2005 y abril de 2006

Variables continuas  A. baumannii sensibleA. baumannii resistentep
  Mediana  IC 95%  Mediana  IC 95% 
Edad  58  40–66  50  43-58  0,8 
Días de hospitalización previa no UCI  1–4  2-5  0,27 
Días de estancia en UCI  15  9–23  18  15-20  0,21 
Días de catéter central  5–14  12  10-15  0,025 
Días de sonda vesical  4–11  13  11-15  0,004 
Días de ventilación mecánica  5–12  11  10-12  0,14 
Días de tubo orotraqueal  4–10  10  8-12  0,088 
Días de primera cirugía  0–10  10  9-12  0,038 
Días de última cirugía  0–6  2-6  0,55 
APACHE II  14  13–18  16,5  15-18  0,32 
Estancia previa a UCI  1–4  1-4  0,11 
Estancia en UCI previa al aislamiento  4–11  10  8-11  0,19 
Estancia hospitalaria previa a aislamiento  11  7–15  17  14-19  0,008 
Estancia hospitalaria después de aislamiento  18  12–26  19  15-24  0,76 
Estancia en UCI posterior al aislamiento  3–13  5-8  0,73 
Días de hospitalización  27  21–44  36  32-40  0,14 

IC 95%: intervalo de confianza del 95%.

Tabla 5.

Resultado de análisis multivariado para factores de riesgo de desarrollar resistencia asociados a infección o colonización por A. baumannii resistente a carbapenémicos en 13 UCI de Bogotá (Colombia), entre abril de 2005 y abril de 2006

Variables  OR  IC 95%
Genotipo Ab22  449  25  798  0,00 
Hospitalización previa  11,9  1,59  89  0,01 
Días de estancia previa  0,96  0,91  0,09 
Infección nosocomial  14,1  2,4  82,2  0,03 
Exposición previa a carbapenémicos  10,36  1,73  61,95  0,00 
Exposición previa a cefalosporinas de tercera  5,53  0,77  3,97  0,09 
Días de ventilación mecánica  16,4  1,93  138,6  1,01 
Exposición a ciprofloxacina  0,211  0m30  1,46  0,11 

IC: intervalo de confianza; OR: odds ratio.

El 43% de los pacientes no recibieron tratamiento antibiótico adecuado. El 78% tuvieron cirugías, el 43% abdominales. La mortalidad atribuible a infección por AB fue mayor cuando la terapia inicial no fue apropiada (datos no mostrados).

Caracterización fenotípica

Se evaluó la susceptibilidad de los 165 aislamientos sin realizar diferencia entre los causantes de colonización o infección, 30 fueron ABSC y 135 ABRC. De estos últimos, 83,7% (n=113) presentaron perfil de multirresistencia (tabla 6). El 35,8% de los aislamientos fueron identificados (por los sistemas automatizados MicroScan, MicroScan WalkAway y VITEK 2) como resistentes o con sensibilidad intermedia a imipenem o meropenem. Entre los aislamientos identificados como resistentes, con el sistema MicroScan WalkAway, se encontró que la concordancia en la identificación de la resistencia con el E-test fue: 100% con imipenem; 82,75% para meropenem; 76,6% para ciprofloxacina; 76,19% para piperacilina tazobactam; 65,71% para piperacilina tazobactam; 55,5% para aztreonam y 36,36% para amikacina.

Tabla 6.

Sensibilidad antimicrobiana de aislamientos de A. baumannii resistentes a carbapenémicos

Antibióticon=135
% R  % I  % S  CIM50 (μg/mL)  CIM90 (μg/mL)  Rango 
Aztreonam  92  64  256  16–256 
Amicacina  44  32  23  48  256  1-256 
Ceftazidima  81  10  48  256  4-256 
Ceftriaxona  100  32  32  32 
Cefepima  98  32  32  4-32 
Ciprofloxacina  96  32  32  0,19-32 
Imipenem  99  32  32  8-32 
Meropenem  100  32  32  16-32 
Piperacilina/tazobactam  99  256  256  32-256 
Ampicilina/sulbactam  56  40  32  256  4-256 
Cefoperazona/sulbactam  32  256  4-256 
Colistina  99  0,38  0,5  0,064-16 

% I: porcentaje de intermedios; % R: porcentaje de resistentes; % S: porcentaje de sensibles; CIM50: concentración inhibitoria mínima 50; CIM90: concentración inhibitoria mínima 90.

Se analizaron 15 aislamientos con el sistema MicroScan. La concordancia en la identificación de aislamientos resistentes con el sistema manual E-test fue: 100% ciprofloxacina; 100% piperacilina tazobactam; 84,6% imipenem; 70% meropenem; 50% cefepime; 50% amikacina y 40% aztreonam. Un total de 19 aislamientos fueron analizados con el sistema VITEK 2.

La concordancia en la identificación de aislamientos resistentes con el método E-test fue: 100% aztreonam; 93,75% imipenem; 88,89% meropenem; 88,89% ciprofloxacina; 81,81% piperacilina tazobactam; 60% cefepima y 0% amikacina. De todos los aislamientos con resistencia a los carbapenémicos, el E-test confirmó dicho perfil en 88,7%. Los otros fueron, en realidad, sensibles a carbapenémicos. La resistencia a otros antibióticos fue para amikacina 9,85%; aztreonam 30,9%; piperacilina tazobactam 40,8%; ciprofloxacina 60,56% y cefepime 81,7%. El cálculo de las CIM50 y CIM90 se realizó con las cepas tratadas mediante la prueba del E-test. La mayor sensibilidad fue a colistina (99%, n=134), excepto un aislamiento (CIM 16μg/mL) y amikacina (23%; n=31) (tabla 7) y 31 aislamientos fueron positivos para MBL.

Tabla 7.

Distribución de los aislamientos del clon Ab22 en las instituciones a través del tiempo del estudio

HospitalesDistribución de los aislamientos del clon Ab22 en las instituciones a través del tiempo del estudioTotal
Abr-05  May-05  Jun-05  Jul-05  Ago-05  Sep-05  Oct-05  Nov-05  Dic-05  Ene-06  Feb-06  Mar-06  Abr-06 
H1                     
H3                     
H4                         
H5                         
H6      48 
H7                10 
H8                     
H9                       
H10                     
H11                 
H12                       
H13                     
Total  10  14  13  89 
Detección de genes codificantes de carbapenemasas y secuenciación de ADN

Todos los aislamientos fueron positivos para OXA-51 (alelos OXA-66, OXA-69, OXA-95 y OXA-99). De los 135 aislamientos ABRC, en 129 se confirmó OXA-23, 5 fueron positivos únicamente para OXA-51 y uno amplificó OXA-24 (de modo que se confirmó OXA-72). Ningún aislamiento amplificó OXA-58, IMP ni VIM.

Electroforesis en gel de campo pulsado

Por EGCP se definieron 46 genotipos: 12 clones (aislamientos genéticamente relacionados) y 34 perfiles únicos (aislamientos no relacionados genéticamente con el resto) (tabla 1). El genotipo más grande fue Ab22 (n=89, aislamientos de ABRC–OXA-23) presentes en 12 instituciones, excepto H2 (tabla 1). El primer aislamiento de Ab22 se hizo en abril de 2005 en H7, y para mayo se realizó en H6, H8 y H13 (tabla 5; fig. 1). Los aislamientos Ab22 se detectaron en 11 de los 12 meses de estudio (tabla 5). El segundo genotipo más grande fue Ab12, presente únicamente en H4 (tabla 1).

Figura 1.

Distribución de los aislamientos del clon Ab22 en las instituciones a través del tiempo del estudio.

(0,14MB).
Discusión

A. baumannii es un agente potencialmente fatal de difícil tratamiento y erradicación en el entorno hospitalario. En este estudio, los factores de riesgo para infección/colonización por ABRC fueron: infección cruzada, hospitalización previa, clon (Ab22) y exposición previa a carbapenémicos por más de 3 días. La duración de la terapia antibiótica ha sido asociada previamente con el desarrollo de resistencia por Marra et al.15, quienes evidenciaron reducción en la frecuencia de aislamientos de AB resistente a imipenem, de 2,7 a 0,2 durante 1.000 días por paciente, al disminuir a 14 días la duración de esquemas de tratamiento antibiótico en UCI. Falagas et al.16 describieron como principal factor de riesgo el uso previo de antibióticos, principalmente carbapenémicos y cefalosporinas de tercera generación, seguido de fluoroquinolonas, aminoglucósidos y metronidazol.

Aunque en principio la exposición a carbapenémicos y cefalosporinas de tercera generación estuvo asociada en el análisis bivariado, en el multivariado la exposición previa a cefalosporinas de tercera generación no se mantuvo como factor de riesgo. Este resultado puede estar relacionado con el bajo poder obtenido, al encontrar una menor frecuencia de aislamientos a la esperada.

La hospitalización previa expone a los pacientes a uso de antibióticos y riesgo de colonización por gérmenes multirresistentes. Este fenómeno ha sido descrito recientemente en estudios de casos y controles en busca de factores de riesgo para resistencia en A. baumannii17,18. La identificación de un agrupamiento en común, definido como Ab22, favorece igualmente la teoría de la infección cruzada a partir de un foco de difícil erradicación y contaminación de superficies por una bacteria con alta capacidad de supervivencia en condiciones ambientales extremas. Por la metodología de este trabajo, no es posible determinar con seguridad los mecanismos de diseminación entre las diferentes instituciones, pero es posible que estos resultados puedan ser explicados por hallazgos de otros estudios de brote, con los que se identificó colonización de equipos, medio ambiente y manos de trabajadores de la salud como principal factor de riesgo17,18.

Se encontró que AB es resistente a carbapenémicos en más del 60% de la mayoría de las instituciones. La diseminación de AB a nivel mundial se asocia con los clones internacionales europeos I, II, III y el panamericano (WW5); este último incluye cepas colombianas19. Estos clones altamente exitosos se propagan fácilmente por infección cruzada. Al parecer, el proceso se inicia con presión antibiótica o selección desde un ancestro común7,20. En este estudio, el agrupamiento fue identificado principalmente en un hospital, el H7, donde tuvo un comportamiento endémico; esto indica que la diseminación en las UCI de Bogotá se asoció posiblemente a transmisión cruzada.

Al considerarse diseminación por infección cruzada, se propone registro previo al traslado de portadores de microorganismos de importancia epidemiológica21,22. Las medidas estrictas y tempranas de aislamiento fueron claves para contener la infección; en contraste, la reacción tardía hizo imposible erradicar el clon Ab22 en un hospital, con incidencia del 16%. Corbella y Van den Broek23,24 proponen que la contención temprana de brotes es fundamental para evitar la perpetuación endémica y el riesgo de que, una vez consolidado el brote, sea difícil identificar la fuente y controlarlo25,26. En este estudio se presentó otro agrupamiento de 13 cepas Ab12 restringido a un solo hospital. Su patrón de presentación indica pequeños focos de exacerbación de una cepa endémica de difícil control en este centro y su persistencia en el medio ambiente.

Más del 80% de los aislamientos fueron multirresistentes, con alta sensibilidad a polimixina, considerada una buena opción de tratamiento para ABRC2. Por otra parte, se considera que la tigeciclina también es una opción de tratamiento en infecciones que no incluyan el torrente sanguíneo y tracto urinario. Asimismo, la combinación terapéutica más eficaz es carbapeneme con polimixina intravenosa y micronebulizada, en algunos casos de neumonía nosocomial27,28. Sulbactam tiene actividad intrínseca frente a AB; su combinación a altas dosis con colistina tiene respuesta del 60% en neumonía27,28.

La cuarta parte de ABRC fueron positivos para MBL con E-test; sin embargo, la PCR mostró resultados negativos para VIM e IMP. Estos falsos positivos con E-test, que han sido previamente descritos29, recomiendan confirmar molecularmente estos resultados fenotípicos o utilizar pruebas con otros inhibidores de MBL, como el EDTA/mercapto acetato de sodio30.

En los ABRC del estudio, OXA-23 fue la enzima prevalente, ratificando lo descrito previamente a nivel mundial y en Colombia31–33. De acuerdo con la literatura, la diseminación de OXA-23 puede asociarse con la propagación de clones o la transferencia horizontal de esta carbapenemasa. Dicho evento se ha asociado con la presencia de la secuencia de inserción ISAba1, la cual puede localizarse en diferentes transposones como Tn200631,34. En Colombia estudios previos han detectado la presencia de ISAba132,33 asociada con OXA-23 y han identificado esta carbapenemasa tanto en cromosoma como en plasmido32. Aunque en nuestro estudio no determinamos la localización de OXA-23, podemos señalar que su diseminación se asoció con la propagación de un clon exitoso (clon Ab22) y en aislamientos no relacionados genéticamente, posiblemente con transferencia horizontal de OXA-23. Adicionalmente en esta investigación se identificó por primera vez OXA-7235; en un aislamiento de A. baumannii en Colombia, el cual presentó un patrón de campo pulsado único.

La mayor prevalencia de infecciones correspondió al torrente sanguíneo, contrario a lo reportado por Baran et al.36, quienes identificaron que el foco más frecuente es la infección del sitio operatorio y, en segundo lugar, el torrente sanguíneo. Este hallazgo alerta sobre la importancia de prevenir la infección asociada a CVC.

Conclusión

Se puede decir que la optimización de medidas de control de infecciones —en algunas instituciones participantes— se tradujo en una menor frecuencia de aislamientos de AB, hecho que impidió alcanzar el tamaño de muestra calculado. También dificultó identificar otros factores asociados. En contraste, permitió deducir que las medidas para prevenir infección cruzada (como higiene de manos, agrupamiento de pacientes, protocolos de limpieza y desinfección y uso racional de antibióticos) pueden controlar y hasta erradicar episodios de infección por ABRC, siempre y cuando se realice una intervención temprana1. Con los hallazgos descritos, se resalta la importancia de aplicar medidas efectivas para prevenir infecciones asociadas a la atención en salud especialmente la bacteriemia asociada a dispositivo y de usar prudentemente los antimicrobianos, con el fin de prevenir la selección y propagación de microorganismos resistentes a los antimicrobianos.

Responsabilidades éticasProtección de personas y animales

Los autores declaran que los procedimientos seguidos se conformaron a las normas éticas del comité de experimentación humana responsable y de acuerdo con la Asociación Médica Mundial y la Declaración de Helsinki.

Confidencialidad de los datos

Los autores declaran que han seguido los protocolos de su centro de trabajo sobre la publicación de datos de pacientes.

Derecho a la privacidad y consentimiento informado

Los autores han obtenido el consentimiento informado de los pacientes o sujetos referidos en el artículo. Este documento obra en poder del autor de correspondencia.

Financiación

El presente proyecto fue financiado por Colciencias CÓDIGO: 11010416355, Contrato 444 y la Universidad Nacional de Colombia código: 20201005279.

Conflicto de intereses

Los autores participantes manifiestan no presentar ningún conflicto de interés.

Agradecimientos

A las instituciones participantes de GREBO:

Clínica de Occidente (Elkin Lemus, Norma Montoya, Marta Salinas, Francelina González, Edgar Sánchez); Clínica Jorge Piñeros Corpas (Geny Díaz, Carlos Barrios); Clínica Reina Sofía (Edilma Torrado, Diego Garzón); Clínica San Pedro Claver (Carlos Alquichire, Martha Ruiz, Gladis Ceballos, Pilar Hurtado, José Guillermo Ruiz Rodríguez); Fundación Cardioinfantil (Álvaro Arango, Patricia Bravo); Hospital Occidente de Kennedy (Romelia Villa, Nubia Escobar, Piedad Giraldo, Álvaro Jiménez); Hospital El Tunal (Marta Isabel Garzón, Julia Quijano, Rafael Pérez Yepes); Hospital Militar Central (Carlos Pérez, Matilde Méndez, María Nilse González, Diana Ferrucho, Juan Pablo Velásquez); Hospital Universitario San Ignacio (Carlos Álvarez, Beatriz Ariza); Hospital Simón Bolívar (Constanza Correa, Luz Janeth Márquez, William Clavijo); Hospital Santa Clara (José Roberto Tamara, Gloria Inés Gallo, Guillermo Ortiz); Hospital Universitario Clínica San Rafael (Marta Pulido, Rabel Lobelo); Hospital Universitario La Samaritana (Johana Osorio, Elsa Marina Zubieta, Emilio Rey); Instituto Nacional de Cancerología (Jorge Cortés, Claudia Patricia Arroyo, Luz Marina Martínez, Elizabeth Rodríguez, Clara Inés Gómez); Policlínico del Olaya (Johana Carol Estrada, Ana Isabel Sánchez, Carlos Hurtado Hurtado).

Bibliografía
[1]
E.V. Lemos, F.P. de la Hoz, T.R. Einarson, W.F. McGhan, E. Quevedo, C. Castañeda, et al.
Carbapenem resistance and mortality in patients with Acinetobacter baumannii infection: Systematic review and meta-analysis.
Clin Microbiol Infect., 20 (2014), pp. 416-423
[2]
M.L. Joly-Guillou.
Clinical impact and pathogenicity of Acinetobacter.
Clin Microbiol Infect., 11 (2005), pp. 868-873
[consultado 17 Sep 2013] Disponible en: doi: http://doi.org/dbc2q6
[3]
N.C. Gordon, D.W. Wareham.
Multidrug-resistant Acinetobacter baumannii: Mechanisms of virulence and resistance.
Int J Antimicrob Agents., 35 (2010), pp. 219-226
[consultado 17 Sep 2013] Disponible en: doi: http://doi.org/ds7b7q
[4]
M.E. Falagas, P.I. Rafailidis.
Attributable mortality of Acinetobacter baumannii: No longer a controversial issue.
Critical Care., 11 (2007), pp. 134-136
[5]
G. Rajamohan, V.B. Srinivasan, W.A. Gebreyes.
Molecular and functional characterization of a novel efflux pump, AmvA, mediating antimicrobial and disinfectant resistance in Acinetobacter baumannii.
J Antimicrob Chemother, 65 (2010), pp. 1919-1925
[6]
GREBO. Boletín informativo. Número 1 [consultado 30 Mar 2015]. Bogotá: GREBO; 2008 [consultado 22 Sep 2013]. Disponible en: http://goo.gl/mt46b7.
[7]
J.M. Coelho, J.F. Turton, M.E. Kaufmann, J. Glover, N. Woodford, M. Warner, et al.
Occurrence of carbapenem-resistant Acinetobacter baumannii clones at multiple hospitals in London and Southeast England.
J Clin Microbiol., 44 (2006), pp. 3623-3627
[8]
M.E. Falagas, I. Bliziotis, I. Siempos.
Attributable mortality of Acinetobacter baumannii infections in critically ill patients: A systematic review of matched cohort and case-control studies.
Crit Care., 10 (2006), pp. R48
[9]
E.V. Lemos, F.P. de la Hoz, N. Alvis, T.R. Einarson, E. Quevedo, C. Castañeda, et al.
Impact of carbapenem resistance on clinical and economic outcomes among patients with Acinetobacter baumannii infection in Colombia.
Clin Microbiol Infect., 20 (2014), pp. 174-180
[10]
I. Foppa, D. Spiegelman.
Power and sample size calculations for case control studies of gene-environment interactions with a polytomous exposure variable.
Am J Epidemiol, 146 (1997), pp. 596-604
[consultado 16 Sep 2013] Disponible en: http://goo.gl/vivVZr
[11]
J.S. Garner, W.R. Jarvis, T.G. Emori, T.C. Horan, J.M. Hughes.
CDC definitions for nosocomial infections.
Am J Infect Control., 16 (1988), pp. 128-140
[consultado 25 Sep 2013] Disponible en: doi: http://doi.org/d69qz9
[12]
N. Woodford, M. Ellington, J.M. Coelho, J. Turton, M. Ward, S. Brown, et al.
Multiplex PCR for genes encoding prevalent OXA carbapenemasas in Acinetobacter spp.
Int J Antimicrob Agents., 27 (2006), pp. 351-353
[13]
R. Mendes, K. Kiyota, J. Monteiro, M. Castanheira, S. Andrade, A. Gales, et al.
Rapid detection and identification of metallo-b- lactamase-encoding genes by real-time PCR Assay and melt curve analysis.
J Clin Microbiol., 45 (2007), pp. 544-547
[consultado 25 Sep 2013] Disponible en: doi: http://doi.org/dcntxc
[14]
H. Seifert, L. Dolzani, R. Bressan, T. van der Reijden, B. van Strijen, D. Stefanik, et al.
Standardization and interlaboratory reproducibility assessment of pulsed-field gel electrophoresis-generated fingerprints of Acinetobacter baumannii.
J Clin Microbiol., 43 (2005), pp. 4328-4335
[consultado 25 Sep 2013] Disponible en: doi: http://doi.org/d6sr2n
[15]
A. Marra, S. de Almeida, L. Correa.
The effect of limit antimicrobial therapy duration on antimicrobial resistance in the critical care setting.
Am J Infect Control., 37 (2009), pp. 204-209
[consultado 25 Sep 2013] Disponible en: doi: http://doi.org/d7hhbz
[16]
M. Falagas, P. Kopterides.
Risk factors for the isolation of multi-drug-resistant Acinetobacter baumannii and Pseudomonas aeruginosa: A systematic review of the literature.
J Hosp Infect., 64 (2006), pp. 7-115
[consultado 25 Sep 2013] Disponible en: doi: http://doi.org/fdd85v
[17]
E. Tsakiridou, D. Makris, Z. Daniil, E. Manoulakas, V. Chatzipantazi, O. Vlachos, et al.
Acinetobacter baumannii infection in prior ICU bed occupants is an independent risk factor for subsequent cases of ventilator-associated pneumonia.
Biomed Res Int., 2014 (2014), pp. 7
[18]
Y. Li, Q. Guo, P. Wang, D. Zhu, X. Ye, S. Wu, et al.
Clonal dissemination of extensively drug-resistant Acinetobacter baumannii producing an OXA-23 β-lactamase at a teaching hospital in Shanghai, China.
J Microbiol Immunol Infect., 48 (2015), pp. 101-108
[consultado 25 Sep 2013] Disponible en: doi: http://doi.org/29f
[19]
P.G. Higgins, C. Dammhayn, M. Hackel, H. Seifert.
Global spread of carbapenem-resistant Acinetobacter baumannii.
J Antimicrob Chemother., 65 (2010), pp. 1317
[20]
N. Woodford, J.F. Turton, D.M. Livermore.
Multiresistant Gram-negative bacteria: The role of high-risk clones in the dissemination of antibiotic resistance.
FEMS Microbiol Rev., 35 (2011), pp. 736-755
[consultado 25 Sep 2013] Disponible en: doi: http://doi.org/bdt5wj
[21]
C. Urban, S. Segal-Maurer.
Considerations in control and treatment of nosocomial infections due to multidrug-resistant Acinetobacter baumannii.
Clin Infect Dis., 36 (2003), pp. 1268-1274
[22]
E. Larson, D. Quiros, T. Giblin, S. Lin.
Relationship of antimicrobial control policies and hospital and infection control characteristics to antimicrobial resistance rates.
Am J Crit Care., 16 (2007), pp. 110-120
[23]
X. Corbella, A. Montero, M. Pujol, M.A. Domiguez, J. Ayats, M.J. Argerich, et al.
Emergence and rapid spread of carbapenem resistance during a large and 1 sustained hospital outbreak of multiresistant Acinetobacter baumannii.
J. Clin Microbiol., 38 (2000), pp. 4086-4095
[24]
P.J. Van den Broek, J. Arends, A. Bernards.
Epidemiology of multiple Acinetobacter outbreaks in the Netherlands during the period 1999-2001.
Clin Microbiol Infect., 12 (2006), pp. 837-843
[consultado 25 Sep 2013] Disponible en: doi: http://doi.org/dkkn4j
[25]
R. Zarrilli, R. Casillo, A. Di Popolo, M.F. Tripodi, M. Bagattini, S. Cuccurullo, et al.
Molecular epidemiology of a clonal outbreak of multidrug-resistant Acinetobacter baumannii in a university hospital in Italy.
Clin Microbiol infect., 13 (2007), pp. 481-489
[consultado 25 Sep 2013] Disponible en: doi: http://doi.org/c99j7g
[26]
J.D. Chan, J.A. Graves, T.H. Dellit.
Antimicrobial treatment and clinical outcomes of carbapenem-resistant Acinetobacter baumannii ventilator-associated pneumonia.
J Intensive Care Med., 25 (2010), pp. 343-348
[consultado 25 Sep 2013] Disponible en: doi: http://doi.org/cw75mg
[27]
M.E. Falagas, G. Sideri, I.P. Korbila, E.K. Vouloumanou, J.H. Papadatos, D.A. Kafetzis.
Inhaled colistin for the treatment of tracheobronchitis and pneumonia in critically ill children without cystic fibrosis.
Pediatr Pulmonol., 45 (2010), pp. 1135-1140
[28]
A.P. Betrosian, F. Frantzeskaki, A. Xanthaki, E.E. Douzinas.
Efficacy and safety of high-dose ampicillin/sulbactam vs. colistin as monotherapy for the treatment of multidrug resistant Acinetobacter baumannii ventilator-associated pneumonia.
J Infect., 56 (2008), pp. 432-436
[29]
H. Segal, G. Elisha.
Use of Etest MBL strips for the detection of carbapenemases in Acinetobacter baumannii.
J Antimicrob Chemother., 56 (2005), pp. 598
[30]
K. Lee, Y.S. Lim, D. Yong, J.H. Yum, Y. Chong.
Evaluation of the Hodge test and the imipenem-EDTA double-disk synergy test for differentiating metallo-beta- 15 lactamase-producing isolates of Pseudomonas spp. and Acinetobacter spp.
J Clin Microbiol., 41 (2003), pp. 4623-4629
[31]
P. Mugnier, L. Poirel, T. Naas, P. Nordmann.
Worldwide dissemination of the bla OXA-23 carbapenemase gene of Acinetobacter baumannii.
Emerg Infect Dis., 16 (2010), pp. 35-40
[consultado 25 Sep 2013] Disponible en: doi: http://doi.org/c3gqf5
[32]
M.V. Villegas, J.N. Kattan, A. Correa, K. Lolans, A.M. Guzman, N. Woodford, et al.
Dissemination of Acinetobacter baumannii clones with OXA-23 carbapenemase in Colombian hospitals.
Antimicrob Agents Chemother., 51 (2007), pp. 2001-2004
[33]
S.Y. Saavedra, J.C. Nuñez, I.Y. Pulido, E.B. Gonzalez, E.M. Valenzuela, M.T. Reguero, et al.
Characterisation of carbapenem-resistant Acinetobacter calcoaceticus-A. baumannii complex isolates in a third-level hospital in Bogotá, Colombia.
Int J Antimicrob Agents., 31 (2008), pp. 389-391
[34]
B.A. Evans, S.G. Amyes.
OXA. β-lactamases.
Clin Microbiol Rev., 27 (2014), pp. 241-263
00117-13
[35]
S.Y. Saavedra, R. Cayô, A.C. Gales, A.L. Leal, C.H. Saavedra.
Early dissemination of OXA-72-producing Acinetobacter baumannii strain in Colombia: A case report.
Braz J Infect Dis., 18 (2014), pp. 678-680
[36]
G. Baran, A. Erbay, H. Bodur, P. Ongürü, E. Akinci, N. Balaban, et al.
Risk factors for nosocomial imipenem–resistant Acinetobacter baumannii infections.
Int J Infect Dis., 12 (2008), pp. 16-21
[consultado 4 Oct 2013] Disponible en: doi: http://doi.org/bnwf4w
Copyright © 2016. ACIN
Opciones de artículo
Herramientas
es en pt
Política de cookies Cookies policy Política de cookies
Utilizamos cookies propias y de terceros para mejorar nuestros servicios y mostrarle publicidad relacionada con sus preferencias mediante el análisis de sus hábitos de navegación. Si continua navegando, consideramos que acepta su uso. Puede cambiar la configuración u obtener más información aquí. To improve our services and products, we use "cookies" (own or third parties authorized) to show advertising related to client preferences through the analyses of navigation customer behavior. Continuing navigation will be considered as acceptance of this use. You can change the settings or obtain more information by clicking here. Utilizamos cookies próprios e de terceiros para melhorar nossos serviços e mostrar publicidade relacionada às suas preferências, analisando seus hábitos de navegação. Se continuar a navegar, consideramos que aceita o seu uso. Você pode alterar a configuração ou obter mais informações aqui.