Buscar en
Enfermedades Infecciosas y Microbiología Clínica
Toda la web
Inicio Enfermedades Infecciosas y Microbiología Clínica Queratitis en un paciente anciano
Información de la revista
Vol. 33. Núm. 5.
Páginas 355-356 (Mayo 2015)
Compartir
Compartir
Descargar PDF
Más opciones de artículo
Visitas
4690
Vol. 33. Núm. 5.
Páginas 355-356 (Mayo 2015)
Diagnóstico a primera vista
Acceso a texto completo
Queratitis en un paciente anciano
Keratitis in an elderly patient
Visitas
...
Margarita Bolaños-Riveroa,
Autor para correspondencia
mbolriv@gobiernodecanarias.org

Autor para correspondencia.
, Juan Luis Toledo-Monzónb, Hanan Zarrifa, Antonio Manuel Martín-Sáncheza
a Servicio de Microbiología, Hospital Universitario Insular de Gran Canaria, Las Palmas de Gran Canaria, España
b Servicio de Oftalmología, Hospital Universitario Insular de Gran Canaria, Las Palmas de Gran Canaria, España
Información del artículo
Texto completo
Bibliografía
Descargar PDF
Estadísticas
Figuras (3)
Mostrar másMostrar menos
Texto completo
Descripción del caso

Paciente de 83 años que acude al servicio de urgencias porque sus familiares aprecian una lesión central en el ojo izquierdo de una semana de evolución. La lesión era de aparición espontánea, sin traumatismo previo, y no era portador de lentes de contacto. Entre sus antecedentes personales destaca que es diabético e hipertenso en tratamiento. Asimismo presenta un glaucoma en tratamiento con betabloqueantes y una queratopatía bullosa desde el año 2002 que requirió trasplante corneal hace 4años. Utiliza corticoides tópicos de forma crónica por queratoplastia fracasada.

A la exploración se aprecia un infiltrado corneal central con adelgazamiento perilesional y neovascularización de la zona. Se recoge muestra de la lesión mediante raspado con espátula de Kimura, inoculando un tioglicolato, una placa de agar chocolate y una extensión para tinción de Gram. Además se obtiene muestra en una torunda tipo Amies. Las muestras se envían al laboratorio de Microbiología y se pauta tratamiento empírico con moxifloxacino vía tópica y voriconazol (tópico y vía oral [200mg cada 12h]). En la tinción de Gram se observan pseudohifas (fig. 1). A las 48h de incubación crecen unas colonias blanquecinas y rugosas en agar chocolate y agar sabouraud-dextrosa (fig. 2). Tras su aislamiento en el medio cromogénico CHROMagar Candida (Becton Dickinson) estas colonias presentan un color rosado a las 48h de incubación y que cambian a azul (fig. 3), siendo más intenso el color azul a medida que avanzaban los días.

Figura 1.

Tinción de Gram del absceso corneal, donde se observan pseudohifas.

(0,04MB).
Figura 2.

Aspecto de las colonias en agar sabouraud a las 48h.

(0,15MB).
Figura 3.

Aspecto de las colonias en CHROMagar a las 48h de incubación.

(0,09MB).
Evolución

Dicha levadura fue identificada como Kodamaea ohmeri mediante la tarjeta YST de Vitek2 (bioMérieux), API® 20C AUX (bioMérieux) y espectrometría de masas MALDI-TOF (Bruker Daltonics, Alemania). Dicha identificación se confirma en el Centro Nacional de Microbiología (Majadahonda) mediante la amplificación de la región ITS1-5,8s-ITS2, para la cual se utilizaron los oligonucleótidos ITS1 (TCCGTAGGTGAACCTGCGG) e ITS4 (TCCTCCGCTTATTGATATGC)1. Se realizó el estudio de la sensibilidad mediante E-test (bioMérieux), usando las placas de RPMI suplementado con glucosa al 2% para anfotericina y equinocandinas y Mueller Hinton GMB para los azoles. Se toman como referencia los puntos de corte de EUCAST para Candida albicans, siendo resistente a fluconazol (CMI 32) y a caspofungina (CMI 32) y sensible a voriconazol (CMI 0,094) y a anfotericinaB (CMI 0,094).

Al paciente se le ve en consulta cada 48h con disminución progresiva del tamaño del absceso, aunque permanece una zona de necrosis central. Debido a que no tiene visión en ese ojo y la conjuntiva está fibrosada (lo que impide hacer un recubrimiento corneal sobre la perforación central), se decidió la enucleación del mismo.

Comentario final

Entre el 6 y el 60% de las queratitis infecciosas están causadas por hongos, dependiendo de la región geográfica, siendo más frecuente los hongos filamentosos en las regiones con climas cálidos y húmedos. Los hongos filamentosos más frecuentemente implicados son Fusariumspp., Aspergillusspp., Acremoniumspp. y Alternariaspp. En cambio, las queratitis por levaduras se presentan cuando existe compromiso de la superficie corneal, en usuarios de corticoides tópicos crónicos y tras procedimientos quirúrgicos2.

Kodamaea (Pichia) ohmeri es la forma ascosporógena, y el teleomorfo de Candida guilliermondii var. membranaefaciens, perteneciente a la familia Saccharomycetaceae, ha sido confundido con Candida guilliermondii, cuyo estado teleomorfo es Meyerozyma guilliermondii. Kodamaea ohmeri puede ser identificada erróneamente como Candida tropicalis, Candida haemulonii o Candida parapsilosis, por lo que la identificación bioquímica o molecular es obligatoria3. Es una levadura ambiental que se emplea en la industria alimentaria para la fermentación de frutas y vegetales. El primer aislado clínico se realizó en 1984, procedente de un líquido pleural, pero fue considerado como contaminante. El primer caso publicado y donde se documenta su poder patógeno fue en 1998 en una paciente inmunodeprimida con fungemia4. Desde entonces se ha descrito como patógeno emergente en pacientes inmunodeprimidos e inmunocompetentes, causando fungemias, endocarditis, peritonitis y celulitis5-10. En las series publicadas, más de un tercio de los casos ocurren en pacientes pediátricos6,7, y la mortalidad atribuible a estas infecciones es alta7,8.

Aunque los datos existentes no permiten recomendar un tratamiento empírico, en la mayoría de estas infecciones se emplea anfotericinaB, con una buena evolución, por lo que se considera un agente de primera línea3. Debido a la escasa penetración intraocular de la anfotericinaB, el voriconazol se ha convertido en una alternativa prometedora de tratamiento, dado su excelente penetración y su gran espectro de cobertura fúngica2. En cuanto a otros antifúngicos, en varios casos publicados, los autores refieren que esta levadura es sensible a las equinocandinas7-9, aunque también hay casos descritos de resistencia10.

En este caso de queratitis existen factores de riesgo para sospechar la etiología fúngica (edad, tratamiento con corticoides, córnea dañada), por lo que está indicado el tratamiento empírico con voriconazol o anfotericinaB11.

La principal característica macroscópica de la morfología de esta colonia es su aspecto rugoso y el cambio de coloración que manifiesta en el medio cromogénico CHROMagar, que no se produce en otra especie de levadura y resulta muy útil en la identificación.

Agradecimientos

Al Dr. Oscar Zaragoza Hernández, del Centro Nacional de Microbiología (Majadahonda).

Bibliografía
[1]
T.J. White, T.D. Bruns, S.B. Lee, J.W. Taylor.
Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics.
PCR Protocols: A Guide to Methods and Applications, pp. 315-322
[2]
F. Mellado, T. Rojas, C. Cumsille.
Fungal keratitis: Review of diagnosis and treatment.
Arq Bras Oftalmol., 76 (2013), pp. 52-56
[3]
M.C. Arendrup, T. Boekhout, M. Akova, J.F. Meis, O.A. Cornely, O. Lortholary, et al.
ESCMID and ECMM joint clinical guidelines for the diagnosis and management of rare invasive yeast infections.
Clin Microbiol Infect., 20 (2014), pp. 76-98
[4]
M.M. Bergman, D. Gagnon, G.V. Doern.
Pichia ohmeri fungemia.
Diag Microbiol Infect Dis., 30 (1998), pp. 229-231
[5]
B.H. Yang, M.Y. Peng, S.H. Hou, J.R. Sun, S.Y. Lee, J.J. Lu.
Fluconazole-resistant Kodamaea ohmeri fungemia asociated with cellulitis: Case report and review of the literature.
Int J Infect Dis., 13 (2009), pp. e493-e497
[6]
I. De Miguel-Martinez, D. Carrillo-Quintero, J.F. Cano-Lira, M. Ojeda-Vargas.
Kodamaea ohmeri: causa de fungemia en un paciente con carcinoma vesical invasivo.
Enfer Infecc Microbiol Clin., 31 (2013), pp. 633-634
[7]
S.T. Shang, J.C. Lin, S.J. Ho, Y.S. Yang, F.Y. Chang, N.C. Wang.
The emerging life-threatening oportunistic fungal pathogen Kodamaea ohmeri: Optimal treatment and literature review.
J Microbiol Immunol Infect., 43 (2010), pp. 200-206
[8]
N. Al-Sweih, Z.U. Khan, S. Ahmad, L. Devarajan, S. Khan, L. Joseph, et al.
Kodamaea ohmeri as an emerging pathogen: A case report and review of the literature.
Med Mycol., 49 (2011), pp. 766-770
[9]
J.S. Lee, J.H. Shin, M.N. Kim, S.I. Jung, K.H. Park, D. Cho, et al.
Kodamaea ohmeri isolates from patients in a university hospital: identification, antifungical susceptibility and pulsed-field gel electrophoresis analysis.
J Clin Microb., 45 (2007), pp. 1005-1010
[10]
J. Eddouzi, A. Lohberger, C. Vogne, M. Manai, D. Sanglard.
Identification and antifungal susceptibility of large collection of yeast strains isolated in Tunisian hospitals.
Med Mycol., 51 (2013), pp. 737-746
[11]
S.S. Tuli.
Fungal keratitis.
Clin Ophthalmol., 5 (2011), pp. 275-279
Copyright © 2014. Elsevier España, S.L.U. y Sociedad Española de Enfermedades Infecciosas y Microbiología Clínica
Opciones de artículo
Herramientas
es en pt

¿Es usted profesional sanitario apto para prescribir o dispensar medicamentos?

Are you a health professional able to prescribe or dispense drugs?

Você é um profissional de saúde habilitado a prescrever ou dispensar medicamentos