Buscar en
Enfermedades Infecciosas y Microbiología Clínica
Toda la web
Inicio Enfermedades Infecciosas y Microbiología Clínica Caracterización fenotípica y genotípica de cepas de Mycobacterium kansasii ai...
Información de la revista
Vol. 23. Núm. 5.
Páginas 254-258 (Mayo 2005)
Compartir
Compartir
Descargar PDF
Más opciones de artículo
Vol. 23. Núm. 5.
Páginas 254-258 (Mayo 2005)
DOI: 10.1157/13074964
Acceso a texto completo
Caracterización fenotípica y genotípica de cepas de Mycobacterium kansasii aisladas en España (2000-2003)
Phenotypic and genotypic characteristics of Mycobacterium kansasii strains isolated in Spain (2000-2003)
Visitas
...
María Soledad Jiménez-Pajaresa, Laura Herreraa, Azucena Valverdea, Pilar Saiza, Juan Antonio Sáez-Nietoa
a Laboratorio de Referencia de Micobacterias. Servicio de Bacteriolog??a. Centro Nacional de Microbiolog??a. Instituto de Salud Carlos III. Madrid. Espa??a.
Información del artículo
Resumen
Texto completo
Bibliografía
Descargar PDF
Estadísticas
Tablas (4)
TABLA 1. Distribución de las cepas identificadas como Mycobacterium kansasii según su procedencia geográfica
TABLA 2. Tamaño de los fragmentos expresados en pares de bases, que corresponden a cada genotipo al digerir con BstEII y HaeIII un fragmento de 439 pb del gen hsp65. Distribución de las cepas de M. kansasii analizadas según el genotipo
TABLA 3. Descripción de las características fenotípicas de cada biotipo. Distribución de las cepas estudiadas de M. kansasii
TABLA 4. Sensibilidad in vitro de las cepas de M. kansasii estudiadas en relación con el genotipo
Mostrar másMostrar menos
Introducción. Mycobacterium kansasii se define como un patógeno oportunista que causa mayoritariamente enfermedad pulmonar. Esta especie representa el 9,7% de las micobacterias no tuberculosas identificadas en el Centro Nacional de Microbiología durante los años 2000-2003. Métodos. En el presente estudio se analizan las características fenotípicas y genotípicas de 298 cepas identificadas como M. kansasii durante este período de tiempo. La caracterización fenotípica se realizó mediante métodos convencionales: características morfológicas, de crecimiento y pruebas bioquímicas. La caracterización genotípica se realizó mediante amplificación de un fragmento del gen hsp65 y posterior digestión con las enzimas BstEII y HaeIII según el método descrito por Telenti. Resultados. El 57,4% de las cepas estudiadas poseían las características fenotípicas propias de M. kansasii, pero en el resto se obtuvieron otros resultados que nos permitieron definir 17 biotipos. Se identificaron cepas pertenecientes a 6 de los 7 genotipos descritos, el 86,6% de las cepas se agrupaban en el genotipo I. Conclusión. Al analizar las características fenotípicas, se obtiene una mayor discriminación para la diferenciación intraespecífica de M. kansasii que al aplicar métodos genotípicos, pero debido al gran número de cepas con características fenotípicas atípicas, algunas de ellas muy específicas para la especie como la fotocromogenicidad, se aconseja la utilización de métodos convencionales y la aplicación de métodos moleculares para la correcta identificación de la especie.
Palabras clave:
Mycobacterium kansasii
Fenotípico
Genotípico
hsp65
Introduction. Mycobacterium kansasii is an opportunistic pathogen that mainly causes pulmonary infections. This species accounted for 9.7% of Mycobacteria other than tuberculosis complex identified in the reference laboratory of the Spanish Centro Nacional de Microbiología during the period of 2000-2003. Methods. In this study we analyzed the phenotypic and genotypic characteristics of 298 M. kansasii strains isolated over this 4-year period. The phenotypic characteristics were determined by conventional methods: biochemical testing, culture and morphological study. Genotypic characteristics were studied using PCR restriction fragment analysis of a fragment of the hsp65 gene and digestion with BstEII and HaeIII, according to the method of Telenti. Results. Among the total of tested strains, 57.4% had the typical phenotypic characteristics described for M. kansasii. The rest had atypical patterns that we grouped into 17 biotypes. Strains belonging to six of the seven described genotypes were identified, with 86.6% of the strains falling into genotype I. Conclusion. Analysis of the phenotypic characteristics of M. kansasii showed a higher discrimination index for intraspecific differentiation than genotypic methods. Nevertheless, the high variability of phenotypic characteristics, some of which were very specific for the species (e.g., photochromogenicity), could complicate their identification. Hence both conventional and molecular methods should be used to accurately identify the atypical isolates.
Keywords:
Mycobacterium kansasii
Phenotypic
Genotypic
hsp65
Texto completo

Introducción

En la actualidad hay descritas y reconocidas más de 100 especies del género Mycobacterium, aunque sólo un pequeño número de ellas se consideran patógenas estrictas para el hombre o los animales1. Las especies del complejo tuberculoso son las responsables de la mayoría de las enfermedades producidas por el género Mycobacterium. El uso de medios de cultivo más sensibles y más ricos que permiten el aislado de cepas de difícil crecimiento, el empleo cada vez más frecuente de técnicas agresivas en medicina, la utilización de fármacos inmunosupresores, la mayor supervivencia de los pacientes con inmunodeficiencias clásicas y, sobre todo, la aparición del virus de la inmunodeficiencia humana (VIH) han sido factores que han hecho aumentar sensiblemente la incidencia de enfermedad en los últimos años por especies micobacterianas no incluidas en el grupo M. tuberculosis complex llamadas micobacterias no tuberculosas (MNT)2,3.

M. kansasii se define como un patógeno oportunista que causa mayoritariamente enfermedad pulmonar, pudiendo ocasionar una infección diseminada que raramente se produce en pacientes no inmunodeprimidos, pero con frecuencia asociada con el sida4-9.

El reservorio natural de M. kansasii es aún desconocido. Algunos investigadores postulan que el agua es su hábitat natural por haber sido aislado ocasionalmente en muestras procedentes de grifos, duchas y sistemas de distribución de agua corriente, medios en los que se ha demostrado que es capaz de sobrevivir durante largos períodos de tiempo10-12. En muy pocas ocasiones se ha recuperado de agua de ríos o de lagos13 y excepcionalmente se ha aislado a partir de muestras procedentes de suelo o de animales14.

El análisis de la secuencia de la región 16S-23S rRNA15, y del gen 16S rRNA16, la amplificación mediante reacción en cadena de la polimerasa (PCR) y posterior digestión del gen hsp65 (PRA)17-19 y la detección de un fragmento de inserción IS165220 subdividen a esta especie en siete genotipos.

Durante los años 2000-2003, el Laboratorio de Referencia de Micobacterias ha identificado 3.086 cepas como micobacterias no tuberculosas, lo que representa el 27,8% de las micobacterias recibidas para su estudio. Las especies identificadas más frecuentemente fueron M. avium (562 cepas), M. gordonae (523), M. fortuitum (298) y M. kansasii (298).

El objeto de este trabajo es la caracterización tanto fenotípica (características morfológicas, de cultivo, bioquímicas y de sensibilidad a los diferentes fármacos antituberculosos) como genotípica (determinar la frecuencia de los siete genotipos mediante PRA) de estas cepas aisladas en España y enviadas al Centro Nacional de Microbiología para su estudio durante los últimos 4 años.

Métodos

Cepas

Se estudiaron 298 cepas (aisladas de 298 pacientes) identificadas como M. kansasii. La mayoría de los aislados (92,6%) procedían de muestras de origen respiratorio, y sólo en 2 pacientes con más de un aislado, las cepas se obtuvieron de diferentes localizaciones (pulmonar y ganglionar). Estas cepas fueron enviadas por 56 hospitales de 14 comunidades autónomas. La distribución geográfica de los aislados se muestra en la tabla 1. En 19 pacientes se obtuvieron aislados múltiples, y aunque sólo se incluyó en el estudio el primero, todos fueron analizados para conocer la reproducibilidad y estabilidad de las técnicas empleadas.

Como cepas tipo se incluyeron dos cepas de M. kansasii ATCC 25101 y ATCC 25100.

Caracterización morfológica y bioquímica

El Laboratorio de Micobacterias identificó todas las cepas como M. kansasii mediante la aplicación de métodos clásicos. El panel usado incluye las características del cultivo sobre medio de Löwenstein-Jensen (LJ): velocidad de crecimiento, producción de pigmento en oscuridad o después de fotoinducción, capacidad de crecimiento a 22, 30, 37 y 45 °C y sobre medios de cultivo hostiles (LJ con 5% de NaCl; LJ con 5 μg/ml de hidralazida del ácido tiofencarboxílico [TCH]; LJ con 10 μg/ml de tiosemicarbazona [TSC] y sobre agar MacConkey sin cristal violeta) y pruebas bioquímicas: producción de niacina, actividad catalásica a 68 °C, reducción de nitratos y telurito potásico, arilsulfatasa (3 días), hidrólisis del Tween 80 (lectura a los 1, 3 y 5 días) y ureasa1.

Pruebas de sensibilidad

Los estudios de sensibilidad se realizaron mediante el método de las proporciones descrito por Canetti et al21 sobre medio de Löwenstein-Jensen, elaborado en el Centro Nacional de Microbiología, frente a isoniazida (H) (0,2, 0,5 y 1 μg/ml), estreptomicina (S) (4 y 8 μg/ml), etambutol (E) (1,5 y 2 μg/ml); rifampicina (R) (20 y 40 μg/ml); PAS (P) (0,5 y 1 μg/ml); cicloserina (C) (30 y 40 μg/ml); kanamicina (K) (20 y 30 μg/ml), y etionamida (T) (20 y 30 μg/ml). La sensibilidad frente a pirazinamida (Z) (50) μg/ml se realizó por el método radiométrico Bactec (Becton Dickinson, EE.UU.) según las indicaciones del fabricante.

Análisis de los patrones de restricción del gen hsp65 (PRA)

Se resuspende un asa de bacteria obtenida a partir de un cultivo sobre LJ en 500 μl de agua destilada y se calienta a 100 °C en baño durante 5 min. Las muestras se centrifugan a 12.000 g durante 5 min y 5 μl del sobrenadante es utilizado para realizar la PCR.

Para la amplificación de un fragmento de 439 pb del gen hsp65 se utilizaron los primers Tb11 (ACCAACGATGGTGTGTCCAT) y Tb 12 (CTTGTCGAACCGCATA CCCT), previamente descritos por Telenti et al18. La PCR se realizó usando el kit comercial PureTaq Ready-To-Go PCR Beads (Amersham Biosciences, Piscataway NJ, EE.UU.) y las condiciones de la PCR se modificaron de las descritas previamente para mejorar la amplificación: un ciclo inicial de desnaturalización de 5 min a 94 °C, seguido por 35 ciclos de 1 min a 95 °C, 1 min a 60 °C, y 90 s a 72 °C. Diez μl del producto de amplificación fueron digeridos con BstEII y otros 10 μl con HaeIII (MBI Fermentas, España). Los fragmentos se analizaron por electroforesis en 3% de agarosa (8066; Pronadisa, Madrid, España), visualizándose con luz UV tras tinción con bromuro de etidio. Como marcador de peso molecular se utilizó el de 50 pb (Amersham Bioscences). Los patrones que corresponden a cada genotipo se muestran en la tabla 2.

El análisis estadístico se realizó para variables cualitativas mediante el test de la ji cuadrado (x2), con el programa informático Epi-Info.

Resultados

El panel utilizado para la identificación de las cepas demostró que el 100% de ellas crecían en más de 7 días, siendo 37 °C la temperatura óptima de crecimiento, inhibiéndose cuando las cepas se incubaron a 22 y 45 °C, crecieron en LJ con 5 μg/ml de TCH, y no se detectó crecimiento en presencia de 10 μg/ml de TSC, en 5% de NaCl ni en agar MacConKey sin cristal violeta. Todas ellas presentaron una fuerte actividad catalásica a 68 °C, ninguna redujo el telurito potásico, ni se detectó arilsulfatasa a los 3 días. Los resultados del resto de las pruebas estudiadas fueron variables lo que permitió definir 17 biotipos (tabla 3) con un índice de discriminación de Simpson del 0,77122. En 127 cepas (42,6%) se obtuvieron resultados que son atípicos con respecto a los que definen la especie, 10 cepas no produjeron pigmento tras fotoinducción, 10 produjeron niacina, 30 no redujeron los nitratos, 6 no hidrolizaron el Tween 80 y 90 lo hicieron más lentamente.

Se identificaron 6 de los 7 genotipos previamente descritos según la distribución que se muestra en la tabla 2. El índice de discriminación de Simpson fue de 0,24622.

Las cepas estudiadas que se aislaron en varias muestras clínicas de un mismo paciente mantuvieron el mismo biotipo y genotipo a lo largo del tiempo.

Los patrones de resistencia fueron bastante homogéneos según los datos que aparecen en la tabla 4. El 80,2% de las cepas tuvieron un mismo patrón, fueron resistentes a H, S, Z, P y K. Las cepas presentaron una resistencia moderada a H, todas ellas fueron sensibles a una concentración de H de 1 μg/ml, tuvieron una resistencia intermedia a 0,5 μg/ml, y fueron resistentes a 0,2 μg/ml.

En caso de aislados múltiples, los patrones de sensibilidad se modificaron tras el tratamiento en 4 de los 19 pacientes. En los 4 casos el patrón de resistencia para el primer aislado fue HSRZK, la cepa obtenida de una segunda muestra con una diferencia superior a 2 meses del primer aislado, además fue resistente a etambutol.

Discusión

Como se observa en la tabla 1, la distribución del porcentaje de aislados de M. kansasii con respecto al número total de MNT identificados en cada Comunidad Autónoma no es homogénea, con porcentajes que varían desde el 26,4% en Cataluña al 0,7% en Castilla-La Mancha. Esta diferencia podría ser debida a las diferentes características de cada comunidad. Las que tienen un mayor porcentaje de aislados poseen una actividad industrial mayor y los núcleos de población se agrupan en grandes zonas urbanas, en el otro extremo, en general, se encuentran comunidades con mayor actividad agrícola donde la población se agrupa en núcleos rurales más pequeños.

La variabilidad fenotípica de M. kansasii es bastante grande, lo que nos ha permitido definir 17 biotipos con un índice de discriminación de 0,771. El 42,6% de las cepas estudiadas tienen características fenotípicas diferentes de las definidas para esta especie, algunas de ellas claves para su identificación como son la producción de pigmento tras la exposición a la luz, o la de niacina23, ya descrita previamente, característica bioquímica casi exclusiva de M. tuberculosis. No existen en la literatura especializada estudios donde se combinen datos sobre la morfología y bioquímica, que permitan conocer la variabilidad fenotípica de esta especie, por lo que no se pueden comparar estos resultados.

Este gran número de cepas atípicas puede dificultar la identificación correcta de esta especie si sólo se utilizan las técnicas convencionales por lo que proponemos además la utilización de métodos moleculares.

La existencia de varios genotipos en M. kansasii está muy documentada en la literatura médica9,16,19,24,25. Como se observa en la tabla 2, nuestros resultados confirman esa heterogeneidad, pero con una distribución nada homogénea. La mayoría de las cepas (86,6%) pertenecían al genotipo I, no encontrando ninguna cepa perteneciente al genotipo VII recientemente descrito por Taillard et al9. El grado de variabilidad encontrado es superior a otros datos publicados previamente con cepas de M. kansasii de zonas geográficas concretas de España. En un estudio realizado en Bilbao por Gaafar et al26, el 99,2% de los aislados identificados como M. kansasii pertenecieron al genotipo I, y en un estudio anterior de Alcaide et al24 con cepas procedentes de muestras clínicas de Barcelona sólo identificaron cepas de M. kansasii del genotipo I. Por el contrario, la prevalencia de cepas de M. kansasii de origen humano en otros países de Europa, pertenecientes a otros genotipos distintos del I, es muy superior. En un estudio realizado en Suiza por Taillard et al9, sólo el 67% de las cepas pertenecían al genotipo I, el 21% pertenecían al genotipo II, el 8% al genotipo III y ya únicamente el 4% pertenecieron a los genotipos IV, VI y VII. En otro estudio similar llevado a cabo por Picardeau et al19, en Francia, en el genotipo I se agruparon el 44% de las cepas, el 33% en el genotipo II, el 5% en el genotipo III, el 10% en el genotipo IV, y el 8% en el genotipo V.

El bajo índice de discriminación que se obtuvo (0,246) hace pensar que el genotipado en España no es un buena técnica para estudios con fines epidemiológicos que permitan conocer el reservorio y las fuentes de infección, pero tiene gran utilidad para identificar correctamente cepas atípicas de M. kansasii.

Al analizar los resultados que se muestran en la tabla 3, sí parece existir una relación entre biotipo y genotipo. El 32,9% de las cepas del genotipo I presentaron características atípicas, mientras que en el resto de los genotipos este porcentaje fue del 72,5% (p = 0,0002). La relación entre las características de las cepas y el genotipo se hace más evidente al analizar los estudios de sensibilidad (tabla 4). Las cepas más sensibles pertenecieron a los genotipos V y III (p = 0,0000001).

Como conclusión cabe destacar que se ha obtenido una mayor discriminación para la diferenciación intraespecífica de M. kansasii cuando se analizan las características fenotípicas que las genotípicas. Creemos necesario la utilización conjunta de métodos convencionales y de métodos moleculares para la correcta identificación de cepas de M. kansasii por el alto número de cepas con características fenotípicas atípicas, algunas de ellas muy específicas para la especie como la fotocromogenicidad.

Bibliografía
[1]
Mycobacterium. En: Murray PR, Baron EJ, Pfaller MA, Tenover FC, Yolken RH, editors. Manual of Clinical Microbiology. 7th ed. Washington: American Society for Microbiology; 1999. p. 399-437.
[2]
Horsburg CR, Selik RM..
The epidemiology of disseminated nontuberculous mycobacterial infection in the adquired immunodeficiency syndrome..
Am Rev Respir Dis, 139 (1989), pp. 4-7
[3]
Urkijo JC, Montejo M, Aguirrebengoa K, Urra E, Aguirre C..
Enfermedad por Mycobacterium kansasii en pacientes con infección por VIH..
Enfer Infecc Microbiol Clin, 11 (1993), pp. 120-5
[4]
Lillo M, Orengo S, Cernoch P..
Pulmonary and disseminated infection due to Mycobacterium kansasii: a decade of experience..
Rev Infect Dis, 12 (1990), pp. 760-7
[5]
Griffith DE..
Management of disease due to Mycobacterium kansaii..
Clin Chest Med, 23 (2002), pp. 613-21
[6]
Block KC, Zwerling L, Pletcher MJ, Hahn JL, Gerberding SM, Ostroff DJ, et al..
Incidence and clinical implications of isolation of Mycobacterium kansasii: results of a 5-year, population-based study..
Ann Inter Med, 129 (1998), pp. 698-704
[7]
Carpenter JL, Parks JM..
Mycobacterium kansasii infections in patients positive for human immunodeficiency virus..
Rev Infect Dis, 13 (1991), pp. 789-96
[8]
Jacobson KL, Teira R, Libshitz HI, Raad I, Rolston KV, Tarrand J, et al..
Mycobacterium kansasii infection in patients with cancer..
Clin Infect Dis, 30 (2000), pp. 965-9
[9]
Taillard C, Greub G, Weber R, Pfyffer GE, Bodmer T, Zimmerli S, et al..
Clinical Implications of Mycobacterium kansasii Species Heterogeneity: Swiss National Survey..
J Clin Microbiol, 41 (2003), pp. 1240-4
[10]
Steadman JE..
High-catalase strain of Mycobacterium kansasii isolated from water in Texas..
J Clin Microbiol, 11 (1980), pp. 496-8
[11]
Bailey RK, Wyles S, Dingley M, Hesse F, Kent GW..
The isolation of high-catalse Mycobacterium kansasii from tap water..
Am Rev Respir Dis, 101 (1970), pp. 430-1
[12]
Goslee S, Wolinsky E..
Water as a source of potentially pathogenic mycobacteria..
Am Rev Resp Dis, 113 (1976), pp. 287-92
[13]
Collins CH, Grange JM, Yates MD..
A review: mycobacteria in water..
Appl Bacteriol, 57 (1984), pp. 193-211
[14]
Wolinsky E, Rynearson TK..
Mycobacteria in soil and their relation to disease- associated strain..
Am Rev Respir Dis, 97 (1968), pp. 1032-7
[15]
Abed Y, Bollet C, De Micco P..
Demonstration of Mycobacterium kansasii species heterogeneity by the amplification of the 16S-23S spacer region..
J Med Microbiol, 42 (1995), pp. 112-4
[16]
Ross BC, Jackson K, Yang M, Sievers A, Dwyer B..
Identification of a genetically distinct subspecies of Mycobacterium kansasii..
J Clin Microbiol, 30 (1992), pp. 2930-3
[17]
Plikaytis BB, Plikaytis BD, Yakrus MA, Butter WR, Woodley CL, Silcox VA, et al..
Differentiation of slowly growing Mycobacterium species, including Mycobacterium tuberculosis, by gene amplification and restriction fragment length polymorphism analysis..
J Clin Microbiol, 30 (1992), pp. 1815-22
[18]
Telenti A, Marchesi F, Balz B, Bally F, Böttger EC, Bodmer T..
Rapid identification of Mycobacterial to the species level by polymerase chain reaction and restriction enzyme analysis..
J Clin Microbiol, 31 (1993), pp. 175-8
[19]
Picardeau M, Prod'Hom G, Raskine L, LePennec MP, Vincent V..
Genotypic characterization of five subspecies of Mycobacterium kansasii..
J Clin Microbiol, 35 (1997), pp. 25-32
[20]
Yang M, Ross BC, Dwyer B..
Identification of an insertion sequence-like element in a subspecies of Mycobacterium kansasii..
J Clin Microbiol, 31 (1993), pp. 2074-9
[21]
Canetti G, Fox W, Khomenko A, Mahler HT..
Advances in techniques of testing Mycobacterial drug sensitivity, and the use of sensitivity test in tuberculosis control programmes..
Bull WHO, 41 (1969), pp. 21-43
[22]
Hunter PR, Gaston MA..
Numerical index of the discriminatory ability of typing systems: an application of Simpsom's index of diversity..
J Clin Microbiol, 26 (1988), pp. 2465-6
[23]
Nachamkin I, MacGregor RR, Staneck JL, Tsang AY, Denner JC, Willner M, et al..
Niacin-positive Mycobacterium kansasii isolated from immunocompromised patients..
J Clin Microbiol, 30 (1992), pp. 1344-6
[24]
Alcaide F, Richter I, Bernasconi C, Springer B, Hagenau C, Schulze-Röbbecke R, et al..
Heterogeneity and clonality among isolates of Mycobacterium kansasii: Implications for epidemiological and pathogenicity studies..
J Clin Microbiol, 35 (1997), pp. 1959-64
[25]
Zhang Y, Mann LB, Wilson RW, Brown-Elliott BA, Vincent V, Iinuma Y, et al..
Molecular analysis of Mycobacterium kansasii isolates from the United States..
J Clin Microbiol, 42 (2004), pp. 119-25
[26]
Gaafar A, Unzaga MJ, Cisterna R, Clavo FE, Urra E, Ayarza R, et al..
Evaluation of a modified single-enzyme amplified-fragment length polymorphism technique for fingerprinting and differentiating of Mycobacterium kansasii Type I isolates..
J Clin Microbiol, 41 (2003), pp. 3846-50
Opciones de artículo
Herramientas
es en pt

¿Es usted profesional sanitario apto para prescribir o dispensar medicamentos?

Are you a health professional able to prescribe or dispense drugs?

Você é um profissional de saúde habilitado a prescrever ou dispensar medicamentos

es en pt
Política de cookies Cookies policy Política de cookies
Utilizamos cookies propias y de terceros para mejorar nuestros servicios y mostrarle publicidad relacionada con sus preferencias mediante el análisis de sus hábitos de navegación. Si continua navegando, consideramos que acepta su uso. Puede cambiar la configuración u obtener más información aquí. To improve our services and products, we use "cookies" (own or third parties authorized) to show advertising related to client preferences through the analyses of navigation customer behavior. Continuing navigation will be considered as acceptance of this use. You can change the settings or obtain more information by clicking here. Utilizamos cookies próprios e de terceiros para melhorar nossos serviços e mostrar publicidade relacionada às suas preferências, analisando seus hábitos de navegação. Se continuar a navegar, consideramos que aceita o seu uso. Você pode alterar a configuração ou obter mais informações aqui.