Buscar en
Endocrinología y Nutrición
Toda la web
Inicio Endocrinología y Nutrición Presencia de la mutación BRAFT1799A en el tumor primario como indicador de ries...
Información de la revista
NOTICE Undefined index: titulo (includes_ws_v2/librerias/html/utilidadesHTML.php[36])
Vol. 58. Núm. 4.
Páginas 175-184 (Abril 2011)
Compartir
Compartir
Descargar PDF
English PDF
Más opciones de artículo
Visitas
7012
NOTICE Undefined index: titulo (includes_ws_v2/librerias/html/utilidadesHTML.php[36])
Vol. 58. Núm. 4.
Páginas 175-184 (Abril 2011)
Original
DOI: 10.1016/j.endonu.2011.02.006
Acceso a texto completo
Presencia de la mutación BRAFT1799A en el tumor primario como indicador de riesgo, recidiva o persistencia de carcinoma papilar de tiroides
BRAFT1799A mutation in the primary tumor as a marker of risk, recurrence, or persistence of papillary thyroid carcinoma
Visitas
...
Marisa Cañadas Garrea,??
Autor para correspondencia
marisacgarre@gmail.com

Autor para correspondencia.
, Martín López de la Torre Casaresb, Patricia Becerra Massarec, Miguel Ángel López Nevotd, Jesús Villar Del Morale, Nuria Muñoz Péreze, Ricardo Vílchez Joyab, Rosa Montes Ramírezf, José Manuel Llamas Elviraa
a Servicio de Medicina Nuclear, Hospital Universitario Virgen de las Nieves, Granada
b Servicio de Endocrinología, Hospital Universitario Virgen de las Nieves, Granada
c Servicio de Anatomía Patológica, Hospital Universitario Virgen de las Nieves, Granada
d Servicio de Análisis Clínicos, Hospital Universitario Virgen de las Nieves, Granada
e Servicio de Cirugía General y del Aparato Digestivo, Hospital Universitario Virgen de las Nieves, Granada
f Departamento de Fisiología, Universidad de Granada
Información del artículo
Resumen
Texto completo
Bibliografía
Descargar PDF
Estadísticas
Tablas (6)
Tabla 1. Prevalencia de la mutación BRAFT1799A en los subtipos de carcinoma papilar de tiroides (CPT)
Tabla 2. Asociación entre las características clinicopatológicas y el estado de la mutación BRAFT1799A en pacientes con carcinoma papilar de tiroides
Tabla 3. Asociación entre las variables relacionadas con recidiva de carcinoma papilar de tiroides y persistencia de la mutación BRAFT1799A
Tabla 4. Asociación entre las variables relacionadas con el tratamiento con I131 y el estado de la mutación BRAFT1799A en los 97 pacientes de carcinoma papilar de tiroides
Tabla 5. Estado de la mutación BRAFT1799A en los 22 pacientes con recidiva tumoral en función de los resultados del último rastreo corporal total
Tabla 6. Resultado del último rastreo corporal total (RCT) y del estado de BRAFT1799A en el momento de la recidiva
Mostrar másMostrar menos
Resumen
Antecedentes y objetivo

La mutación BRAFT1799A se ha relacionado con características tumorales de más agresividad, recidiva tumoral y persistencia de carcinoma papilar de tiroides (CPT), aunque no todos los estudios apoyan esta asociación. En éste, se analiza la asociación entre la presencia de la mutación BRAFT1799A en el tumor primario de pacientes con CPT y las características clinicopatológicas de riesgo, recidiva y persistencia tumoral.

Pacientes, material y método

Hemos seguido a 97 pacientes intervenidos de CPT durante una mediana de 64,1 meses. La mutación BRAFT1799A se determinó en ácido desoxirribonucleico procedente de muestras de la tiroidectomía inicial mediante amplificación por PCR del exón 15 del gen braf y análisis de los fragmentos de restricción con la enzima TspRI. Los casos positivos fueron confirmados por secuenciación. La asociación estadística entre la mutación BRAFT1799A y las diferentes variables se estudió mediante los correspondientes tests de contraste de hipótesis más regresión logística.

Resultados

El 46,4% de los pacientes eran positivos para la mutación BRAFT1799A. Tras análisis bivariante y multivariante, la mutación BRAFT1799A sólo se asociaba con edad superior a 60 años (odds ratio [OR] = 5,5; intervalo de confianza [IC] del 95%, 1,4-21,9; p=0,019) y tamaño de 1cm o superior (OR=3,6; IC del 95%, 1,2-10,3; p=0,016). No se asociaba con subtipos histológicos, metástasis, recidiva, necesidad de nuevos tratamientos ablativos con I131 o de otras intervenciones quirúrgicas debidas a la aparición de metástasis o persistencia de enfermedad al final del seguimiento.

Conclusiones

La mutación BRAFT1799A está asociada a edad superior a 60 años y tamaño tumoral de 1cm o mayor, pero no con otras características clinicopatológicas, recidiva tumoral o persistencia de enfermedad.

Palabras clave:
Mutación BRAFT1799A
Carcinoma papilar de tiroides
Recidiva tumoral
Abstract
Background and objective

The BRAFT1799A mutation is reported to be associated to aggressive, persistent, and recurrent tumor in papillary thyroid carcinoma (PTC) patients. Association of the BRAFT1799A mutation in the primary tumor with the clinicopathological characteristics of PTC patients was analyzed.

Patients, material and methods

Ninety-seven PTC patients were followed up for a median of 64.1 months. The BRAFT1799A mutation was analyzed in DNA from initial thyroidectomy biopsies by PCR amplification and restriction fragment length polymorphism using TspRI enzyme. Positive cases were confirmed by DNA sequencing. Statistical association between BRAFT1799A mutation and clinicopathological characteristics was analyzed by the relevant hypothesis tests and logistic regression.

Results

46.4% of patients were positive for the BRAFT1799A mutation. Bivariate and multivariate analysis showed the BRAFT1799A mutation to be only associated to age over 60years (odds ratio [OR] = 5.5; 95% confidence interval [CI],1.4-21.9; p=0.019) and to tumor size of 1cm or greater (OR=3.6, 95% CI, 1.2-10.3; p=0.016). The BRAFT1799A mutation was not associated to histological subtype, metastasis, recurrence, more aggressive treatments (ablative I131 therapy or surgery), or PTC persistence at the end of follow-up.

Conclusions

The BRAFT1799A mutation is associated to age over 60 and a tumor size of 1cm or greater, but not to other clinicopathological characteristics, tumor recurrence or PTC persistence.

Keywords:
BRAFT1799A mutation
Papillary thyroid carcinoma
Tumor recurrence
Texto completo
Introducción

El cáncer de tiroides es un tumor con una incidencia baja pero creciente en todo el mundo (10,2 casos por 100.000 habitantes/año), especialmente debido a la detección de carcinomas papilares de tiroides (CPT) de pequeño tamaño (menor de 2 cm)1,2. El CPT constituye más del 70% de las neoplasias malignas derivadas de células foliculares3.

Aunque el pronóstico del CPT es generalmente bueno, un subgrupo de estos pacientes presenta un pronóstico peor, con un 12% de fallecimientos, y una proporción mayor presenta morbilidad debida a recidiva tumoral4.

El riesgo de recidiva o fallecimiento se relaciona con varios parámetros, entre los que se encuentran principalmente edad, sexo, tamaño tumoral, metástasis, multifocalidad, invasión extratiroidea, capsular y vascular5. El reconocimiento y la evaluación de estos factores pronósticos, combinado con datos de factores moleculares que evalúen el riesgo de recidiva, podrían servir para estratificar a los pacientes y seleccionar modalidades de tratamiento específicas.

Los CPT con frecuencia presentan mutaciones en genes que codifican proteínas implicadas en la ruta de señalización MAPK (Mitogen-activated protein [MAP] kinases)6. BRAF es uno de los tres miembros de la conservada familia de serina treonina cinasas RAF (ARAF, BRAF y CRAF), que son efectores clave de la ruta canónica MAPK (RAF-MEK-ERK). Las mutaciones puntuales del gen braf son en su mayoría (alrededor del 90%) de un solo tipo, las que implican la transversión de la timina situada en la posición 1799 de la secuencia del gen a una adenina (T1799A), lo cual resulta en la sustitución del aminoácido valina, localizado en la posición 600 de la proteína, por un glutamato (V600E)7,8. La mutación BRAFT1799A constituye la principal alteración genética del CPT, con una frecuencia aproximada del 45%, aunque el porcentaje varía según las series entre el 20 y el 83%7.

Algunos estudios han descrito una asociación entre la mutación BRAFT1799A y características tumorales de más agresividad, como son una mayor edad al diagnóstico, sexo masculino, extensión extratiroidea, metástasis, estadio tumoral avanzado en el momento del diagnóstico, así como recidiva tumoral9,10. Se la ha descrito como un predictor independiente de recidiva tumoral, incluso en pacientes con estadio I-II9. También se ha asociado a la disminución de la capacidad de captación de I131 y fracaso del tratamiento de las recurrencias9,11. Aun así, no todos los estudios coinciden en aceptar que la mutación BRAFT1799A sea un marcador de más agresividad y peor pronóstico9,10,12.

El objetivo del presente estudio fue analizar la asociación de la presencia de la mutación BRAFT1799A en el tumor primario de pacientes con CPT con las características clinicopatológicas de riesgo alto relevantes para el pronóstico del CPT, así como con la recidiva tumoral y la persistencia de enfermedad.

Material y métodosSujetos de estudio

Se estudiaron las características clinicopatológicas y la presencia de la mutación BRAFT1799A en 97 pacientes diagnosticados de CPT en el Hospital Universitario Virgen de las Nieves durante el período comprendido entre el 1 de enero de 1998 y el 30 de mayo de 2007. Se realizó un seguimiento de los pacientes hasta el 1 de septiembre de 2008 (mediana de seguimiento: 64,1 [28,9-91,1]; mínimo: 15,8 y máximo: 129,8 meses).

Se consideró recidiva de CPT la confirmación cito/histopatológica de la lesión en casos de exéresis, ya fuera en lecho tiroideo, o de metástasis ganglionares o a distancia, o su puesta en evidencia mediante métodos de imagen (gammagrafía tiroidea, ecografía [ECO], tomografía computarizada [TC], resonancia magnética [RM], tomografía por emisión de positrones/TC [PET/TC]) asociados a un aumento de tiroglobulina (Tg) y/o un rastreo corporal total (RCT) positivo a partir del segundo RCT con I131.

Para el análisis del estado al final del seguimiento, sólo se incluyó a los pacientes con un mínimo de 27 meses de seguimiento (74 casos). Se consideraron libres de enfermedad los pacientes cuyas concentraciones séricas de Tg (como marcador de mayor sensibilidad) se mantuvieran negativas (menores de 1 ng/ml) en ausencia de interferencia de anticuerpos anti-Tg durante los últimos 24 meses, y los dos RCT consecutivos durante ese período fueran también negativos. Para considerarlos libres de enfermedad cuando la presencia de anticuerpos anti-Tg podía interferir con Tg negativas, se practicaron pruebas adicionales de imagen (gammagrafía tiroidea, ECO, PET/TC, TC, RM).

El desarrollo de este estudio contó con la aprobación del Comité Ético y de Investigación del Hospital Universitario Virgen de las Nieves, así como con el consentimiento informado por parte de los pacientes incluidos.

Muestras

Para el análisis genético, se usaron muestras de tejido procedente de la tiroidectomía incluido en parafina. Se realizaron 5 cortes de 7μm de la zona más representativa del diagnóstico histopatológico, seleccionados por un patólogo experto en enfermedad tiroidea. En el caso de tumores con tamaño ≤ 1cm, la extracción de tejido del bloque de parafina se realizó usando una aguja de 0,6mm con el Manual Tissue Arrayer I (Beecher Instruments Inc, Sun Prairie, WI [Estados Unidos]).

Extracción de ADN

La extracción del ácido desoxirribonucleico (ADN) se llevó a cabo con el QIAamp DNA Mini Kit (Qiagen GmBH, Hilden [Alemania]), de acuerdo con las recomendaciones del fabricante.

Amplificación por PCR del exón 15 del gen braf

Para cada amplificación por PCR, se usó aproximadamente 100 ng de ADN celular total. La PCR se realizó usando los primers específicos para el exón 15 de braf descritos por Davies et al7 (forward primer: 5’-TCATAATGCTTGCTCTGATAGGA; reverse primer: 5’- GGCCAAAAATTTAATCAGTGGA), y el protocolo de amplificación descrito por Cohen et al13.

Análisis de la mutación de BRAFT1799A

El estado de la mutación BRAFT1799A se estableció en primer lugar mediante análisis del polimorfismo en la longitud de los fragmentos de restricción con la enzima de restricción TspRI, según el protocolo descrito previamente por Cohen et al14. En las muestras que resultaron positivas, se confirmó la presencia de la mutación mediante secuenciación bidireccional usando el mismo set de primers con los reactivos Big Dye terminator v1.1 (Applied Biosystems, Foster City, CA [Estados Unidos]); el programa de amplificación fue el siguiente: 94°C durante 3 min×1 ciclo; 96°C durante 10 seg, 58°C durante 5 seg y 60°C durante 4 min×25 ciclos. La lectura de la secuencia se realizó en un secuenciador ABI PRISM 3130xl Genetic Analyzer (Applied Biosystems, Foster City, CA [Estados Unidos]).

Análisis estadístico

En el análisis bivariante, para las variables cualitativas se empleó el test de la χ2 de Pearson con corrección de continuidad para tablas 2×2, o el test de Fisher en los casos en que fue necesario. En el caso de variables continuas, se aplicó el test de la t de Student o el test no paramétrico U de Mann-Whitney, según la normalidad o no de la variable.

Para el análisis multivariante, se ajustó un modelo de regresión logística mediante el método de selección de variables por pasos hacia atrás (backward stepwise selection).

Se consideraron significativos valores de p < 0,05.

El análisis de los datos se realizó mediante el programa estadístico SPSS 15.0 para Windows (SPSS Inc., Chicago, IL [Estados Unidos]).

ResultadosPrevalencia de la mutación BRAFT1799A en CPT

Cuarenta y cinco de los 97 pacientes diagnosticados de CPT (46,4%) resultaron positivos para la mutación BRAFT1799A. En la tabla 1 se muestra la distribución de la presencia de la mutación BRAFT1799A en los distintos subtipos de CPT. Todos los tumores de la variante histológica de células altas y células claras mostraban la mutación BRAFT1799A. Las variantes clásica (24/44; 54,5%) y folicular (8/14; 57,1%) resultaron positivas en algo más de la mitad de los pacientes. La positividad en los microcarcinomas papilares fue del 31,3%.

Tabla 1.

Prevalencia de la mutación BRAFT1799A en los subtipos de carcinoma papilar de tiroides (CPT)

    BRAFT1799A 
Subtipo histológico  Porcentaje por histología 
CPT clásico  44  20  24  54,5 
microCPT  32  22  10  31,3 
CPT-variante folicular  14  57,1 
CPT-células altas  100 
CPT-células claras  100 
CPT-sólido trabecular 
CPT-esclerosante difuso 
CPT-variante folicular difusa 
Total  97  52  45  46,4 
Edad y sexo

Aunque la edad y el sexo como variables continuas no se asociaron con la presencia de la mutación BRAFT1799A, la frecuencia de la mutación BRAFT1799A era mayor en pacientes de edad avanzada, encontrándose una asociación estadística entre los pacientes con más de 60 años y la presencia de la mutación BRAFT1799A (tabla 2).

Tabla 2.

Asociación entre las características clinicopatológicas y el estado de la mutación BRAFT1799A en pacientes con carcinoma papilar de tiroides

  N (-/+)  BRAFT1799A –  BRAFT1799ARR  IC del 95%  valor p 
Edad, años  97 (52/45)  44,4±14,8  47,2±16,7  ---  ---  0,395 
Edad superior a 60 años  97 (52/45)  6 (11,5%)  13 (28,9%)  2,5  (1,0-6,0)  0,041 
Sexo masculino  97 (52/45)  5 (9,6%)  8 (17,8%)  0,9  (0,8-1,1)  0,371 
Tamaño tumoral, cm  84 (42/42)  1,0 [0,6-1,9]  1,7 [1,2-2,5]  ---  ---  0,007 
Tamaño tumoral ≥ 1 cm  84 (42/42)  24 (57,1%)  35 (83,3%)  1,5  (1,1-2,0)  0,016 
Multifocalidad  72 (40/32)  8 (20,0%)  13 (40,6%)  2,0  (1,0-4,3)  0,071 
Invasión extratiroidea  97 (52/45)  6 (11,5%)  6 (13,3%)  1,2  (0,4-3,3)  1,000 
Metástasis ganglionares  97 (52/45)  15 (28,8%)  18 (40,0%)  1,3  (0,8-2,0)  0,287 
Metástasis a distancia  97 (52/45)  2 (3,8%)  1 (2,2%)  0,6  (0,1-6,2)  1,000 
Estadio tumoral (AJCC)  97 (52/45)           
  39 (75,0%)  26 (57,8%)       
II    6 (11,5%)  11 (24,4%)       
III    6 (11,5%)  7 (15,6%)       
IV    1 (1,9%)  1 (2,2%)       
Estadio tumoral II-III-IV  97 (52/45)  13 (25,0%)  19 (42,2%)  1,7  (0,9-3,0)  0,086 
Invasión capsular  50 (24/26)  12 (50,0%)  11 (42,3%)  0,8  (0,5-1,5)  0,777 
Invasión vascular  46 (22/26)  7 (31,8%)  6 (25,0%)  0,8  (0,3-2,0)  0,746 
Necrosis tumoral  52 (24/28)  3 (12,5%)  5 (17,9%)  1,4  (0,4-5,4)  0,711 
Actividad mitótica  49 (25/24)           
Ausente    1 (4,0%)  1 (4,2%)       
Leve    20 (80,0%)  22 (91,6%)       
Moderada    3 (12,0%)  1 (4,2%)       
Alta    1 (4,0%)  0 (0,0%)       
Moderada/alta  49 (25/24)  4 (16%)  1 (4,2%)  0,3  (0,0-2,2)  0,349 

AJCC: American Joint Committee on Cancer; IC: intervalo de confianza; RR: riesgo relativo.

Variables cuantitativas cuya distribución es normal: media ± desviación estándar.

Variables cuantitativas cuya distribución no es normal: mediana [percentil 25-percentil 75].

Variables categóricas: número (porcentaje de BRAF+/-).

Tamaño tumoral

La mediana del tamaño tumoral de los pacientes negativos y positivos para BRAFT1799A fue de 1,0 y 1,7cm, respectivamente (tabla 2). El análisis de la distribución del estado de la mutación BRAFT1799A en función del tamaño tumoral en estos pacientes reveló asociaciones significativas de la mutación BRAFT1799A con un mayor tamaño tumoral (tabla 2) (p=0,007). En particular, la presencia de la mutación BRAFT1799A se encontró con mayor frecuencia en CPT de tamaño igual o superior a 1cm (p=0,016; tabla 2), con un riesgo relativo de 1,5 (intervalo de confianza [IC] del 95%, 1,1-2,0).

Estadio

La mayor parte de los pacientes (65/97; 67,0%) presentaron un estadio I según la American Joint Committee on Cancer, de los cuales el 40,0% (26/65) resultaron positivos para la presencia de la mutación BRAFT1799A en su tumor primario. Aunque a partir del estadio I se observó que el número de pacientes positivos para la mutación BRAFT1799A siempre era mayor que el número de pacientes negativos en el correspondiente estrato, no se encontró una asociación significativa entre la presencia de la mutación BRAFT1799A en el tejido tumoral del CPT y un estadio superior a I (p=0,086; tabla 2).

El análisis multivariante mediante regresión logística mostró como únicas variables clínicas asociadas estadísticamente con la presencia de la mutación BRAFT1799A la edad superior a 60 años (odds ratio [OR] = 5,5; IC del 95%, 1,4-21,9; p=0,019) y tamaño de 1cm o superior (OR=3,6; IC del 95%, 1,2-10,3; p=0,016).

Subtipos histológicos

La mutación BRAFT1799A no se encontró asociada a ningún subtipo histológico, y la estratificación por variante histológica en el análisis de las características clinicopatológicas más importantes (metástasis linfáticas y a distancia, extensión peritiroidea, multifocalidad, tamaño) no generó ninguna diferencia significativa en cuanto a la distribución de la presencia de la mutación BRAFT1799A.

Metástasis

La aparición de metástasis regionales o a distancia en los pacientes BRAFT1799A positivos (el 40,0 y el 2,2%, respectivamente; tabla 2) tuvo lugar con una frecuencia similar a la de los pacientes negativos para BRAFT1799A.

Otras características histopatológicas

Para el resto de las variables histopatológicas (multifocalidad, invasión extratiroidea, invasión capsular, invasión vascular, actividad mitótica, necrosis tumoral), no se encontraron diferencias estadísticamente significativas de su distribución en pacientes BRAFT1799A positivos y negativos (tabla 2).

Asociación de la presencia de la mutación BRAFT1799A con la recidiva y persistencia tumoral

La mediana del tiempo de seguimiento fue de 64,1 (28,9-91,1) meses. De los 97 pacientes, 22 (22,7%) presentaron recidiva de CPT. Estos 22 pacientes presentaban una edad media de 48,3±17,3 años, y la relación varón:mujer fue de 4:18. El tamaño de sus lesiones iniciales había oscilado entre 0,3 y 8,0cm (mediana: 2,3 [0,9-4,0] cm), con un 70,6% de pacientes con tamaño tumoral superior a 1cm de diámetro. De ellos, el 45,5% (10/15) presentó multifocalidad de la lesión inicial, y en el 31,8% (7/22) el CPT había invadido tejido peritiroideo. El 63,6% de los pacientes con recidiva (14/22) había presentado metástasis ganglionares en el momento del diagnóstico, y el 4,5% de ellos (1/22) también presentaba metástasis a distancia.

La mutación BRAFT1799A se encontró presente en el tumor primario del 40,9% (9/22) de los pacientes que posteriormente recidivaban. El 81,8% (18/22) de los pacientes con recidiva necesitó más de una dosis de I131, y en el 31,8% (7/22) fue necesaria una segunda intervención quirúrgica. Al final del seguimiento, el 50% (11/22) de estos pacientes mostraban persistencia de enfermedad tiroidea.

La duración del seguimiento fue similar en pacientes con CPT positivos para la presencia de la mutación BRAFT1799A (mediana: 59,8 [27,3-93,8] meses) y negativos (mediana: 68,2 [29,5-94,5] meses) (tabla 3).

Tabla 3.

Asociación entre las variables relacionadas con recidiva de carcinoma papilar de tiroides y persistencia de la mutación BRAFT1799A

  N (–/+)  BRAFT1799A –  BRAFT1799ARR  IC del 95% 
Recidiva tumoral  97 (52/45)  13 (25,0%)  9 (20,0%)  0,8  (0,4-1,7)  0,631 
Más de un tratamiento de I131  97 (52/45)  11 (21,2%)  7 (15,6%)  0,7  (0,3-1,7)  0,603 
Necesidad de una segunda intervención quirúrgica  97 (52/45)  2 (3,8%)  5 (11,1%)  2,9  (0,6-14,2)  0,244 
Enfermo al final seguimiento  76 (42/34)  5 (11,9%)  6 (17,6%)  1,5  (0,5-4,4)  0,527 
Tiempo seguimiento, meses  97 (52/45)  68,2 [29,5-94,5]  59,8 [27,3-93,8]  ---  ---  0,385 

IC: intervalo de confianza; RR: riesgo relativo.

Variables cuantitativas cuya distribución no es normal: mediana (percentil 25-percentil 75).

Variables categóricas: número (porcentaje de BRAF+/-).

La aparición de recidiva tumoral no se encontró asociada con la presencia de la mutación BRAFT1799A en el tumor primario. Aunque la frecuencia de recidiva en pacientes BRAFT1799A negativos (13/52; 25,0%) fue mayor que en los positivos (9/45; 20,0%), esta diferencia no fue estadísticamente significativa (tabla 3). La estratificación por variable histológica no generó ninguna diferencia significativa en cuanto a la distribución de la presencia de la mutación BRAFT1799A en pacientes con/sin recidiva.

La presencia de la mutación BRAFT1799A en el tumor primario de estos pacientes tampoco se encontró asociada a la necesidad de nuevos tratamientos ablativos con I131 o de otras intervenciones quirúrgicas debidas a la aparición de metástasis (tabla 3). La relación entre la mutación BRAFT1799A y la persistencia de enfermedad tiroidea al final del estudio se analizó en 76 pacientes con más de 27 meses de seguimiento, 11 de los cuales presentaban enfermedad tiroidea. La mutación BRAFT1799A se encontró presente en el tumor primario en el 54,5% de los pacientes enfermos (6/11) (tabla 3). Sin embargo, no se encontró una asociación estadísticamente significativa entre la presencia de la mutación BRAFT1799A y la persistencia de enfermedad al final del seguimiento.

Asociación de la presencia de la mutación BRAFT1799A con las variables relativas al tratamiento con I131 en CPT

Trece pacientes no recibieron tratamiento ablativo de restos quirúrgicos con I131, de los que el 46% (6/13) había presentado la mutación BRAFT1799A en el tumor primario (tabla 4). Nueve de los pacientes presentaban microcarcinoma papilar de tiroides; uno, un carcinoma renal metastásico; otro, osteosarcoma; otro, metástasis cerebral, y otro de 17 años de edad había tenido una tumoración de 1,2cm.

Tabla 4.

Asociación entre las variables relacionadas con el tratamiento con I131 y el estado de la mutación BRAFT1799A en los 97 pacientes de carcinoma papilar de tiroides

    BRAFT1799A
  N (–/+)  – (52)  + (45)  RR  IC del 95%  valor p 
Número de tratamientos con I131  97 (52/45)           
  7 (13,5%)  6 (13,3%)       
  34 (65,4%)  32 (71,1%)       
  9 (17,3%)  4 (8,9%)       
  2 (3,8%)  3 (6,7%)       
Más de un tratamiento de I131  97 (52/45)  11 (21,2%)  7 (15,6%)  0,7  (0,3-1,7)  0,603 
Dosis inicial de I131 mayor a 100 mCi  84 (45/39)  8 (17,8%)  10 (25,6%)  1,4  (0,6-3,3)  0,432 
Dosis total de 131I (mCi)  84 (45/39)          0,554 
Hasta 100 mCi    30 (66,7%)  25 (64,1%)       
100-200 mCi    9 (20,0%)  10 (25,6%)       
200-300 mCi    4 (8,9%)  4 (10,3%)       
Más de 300 mCi    2 (4,4%)  0 (0,0%)       

IC: intervalo de confianza; RR: riesgo relativo.

Variables cuantitativas cuya distribución no es normal: mediana (percentil 25-percentil 75).

Variables categóricas: número (porcentaje de BRAF+/-).

La dosis terapéutica con I131 en el rastreo anual (posterior a la ablación inicial) fue necesaria para 18 pacientes, 7 de los cuales presentaron la mutación BRAFT1799A en el tumor primario (38,9%), mientras que 11 pacientes resultaron negativos (61,1%). Así, el porcentaje de pacientes positivos para la mutación BRAFT1799A que necesitó más de una dosis de tratamiento con I131 fue inferior al de negativos (el 15,6 frente al 21,2%), diferencia que no resultó ser estadísticamente significativa (tabla 4).

Tampoco se encontraron diferencias significativas en las dosis iniciales o totales de I131 recibidas por los pacientes incluidos en el estudio, en función de la presencia de la mutación BRAFT1799A en el tumor primario (tabla 4).

En los 22 pacientes del grupo de seguimiento que habían presentado recidiva se analizó el resultado del último RCT, en función del estado de la mutación BRAFT1799A en el tumor primario. El RCT resultó positivo en 3 casos, uno de los cuales recibió una dosis de I131. Los 2 restantes fueron sometidos a cirugía. La histopatología tras la exéresis de la lesión reveló una linfadenitis en uno de los casos y confirmó la metástasis en el otro, el único cuyo tumor primario presentaba la mutación BRAFT1799A (tabla 5).

Tabla 5.

Estado de la mutación BRAFT1799A en los 22 pacientes con recidiva tumoral en función de los resultados del último rastreo corporal total

RCTTg/ECO/TCPETBRAFT1799A
      – 
Positivo         
Negativo  19  Negativo  11     
    Positivo  Negativo 
        Positivo 
            13 

ECO: ecografía; PET: tomografía por emisión de positrones; RCT: rastreo corporal total; TC: tomografía axial computarizada; Tg: tiroglobulina > 1 ng/ml.

De los 19 pacientes con RCT negativo, 8 presentaron sospecha de recidiva por elevación de los valores de Tg o aparición de lesiones en alguna de las pruebas de imagen (ECO/TC). La PET y la histopatología resultaron positivos en 3 de estos 8 pacientes, los cuales presentaban además la mutación BRAFT1799A en el tumor primario. En el cuarto paciente con RCT negativo, concentraciones de Tg elevadas y presencia de lesiones en la PET, la histopatología tras la cirugía reveló linfadenitis, por lo que no se confirmó la recidiva (tabla 5). La distribución de la mutación BRAFT1799A entre pacientes con RCT positivo y negativo o entre pacientes con RCT negativo y PET positiva o negativa no resultó diferente estadísticamente.

Así, en este grupo de pacientes, 5 presentaron una recidiva confirmada en el momento del último RCT. De los 4 pacientes positivos para BRAFT1799A, 3 (75%) presentaron un RCT negativo en el momento de la recidiva, aunque sin significación estadística (tabla 6).

Tabla 6.

Resultado del último rastreo corporal total (RCT) y del estado de BRAFT1799A en el momento de la recidiva

  BRAFT1799A
RCT    –  Total 
  – 
 
  Total 

En resumen, no se observaron asociaciones estadísticamente significativas entre la presencia de la mutación BRAFT1799A y los parámetros relacionados con el tratamiento con I131 analizados en este estudio.

Discusión

Aunque en general los pacientes con CPT presentan un buen pronóstico, aproximadamente el 10-15% de los casos no son curados con el tratamiento inicial, que consiste en tiroidectomía total y ablación posquirúrgica de restos tiroideos con I131. Muchos desarrollan recidiva y algunos incluso mueren de esta enfermedad4.

Teniendo en cuenta que la incidencia de CPT se encuentra en aumento, sería de gran ayuda complementar los sistemas actuales de estratificación del riesgo con marcadores moleculares, como se ha indicado respecto a la mutación BRAFT1799A, en particular para la toma de decisiones quirúrgicas y de manejo clínico9.

Muchos autores han investigado la relación de la mutación BRAFT1799A con las características clinicopatológicas del CPT10. Aunque los resultados no son concluyentes, la mayoría de los estudios de varios orígenes étnicos y geográficos demuestran una asociación significativa de la mutación BRAFT1799A con una o más características clinicopatológicas de riesgo alto del CPT9,10,12, entre las que destacan la invasión extratiroidea, las metástasis ganglionares y los estadios clinicopatológicos III/IV por predecir de forma más fiable la progresión, la recidiva, la agresividad y, en último lugar, la mayor morbilidad y la mortalidad del CPT9. Muchos estudios han mostrado que la mutación BRAFT1799A se encuentra más frecuentemente asociada a estos 3 predictores de riesgo9,15–17, encontrando una OR de 2,50 para invasión extratiroidea, 1,83 para metástasis ganglionares y 2,14 para estadios avanzados (III/IV)9.

En el presente estudio, no se ha encontrado asociación de la presencia de la mutación BRAFT1799A en el tumor primario de los pacientes con CPT con ninguno de estos 3 factores pronósticos, aunque sí se ha constatado una asociación entre BRAFT1799A con mayor edad y tamaño tumoral, tal como han descrito otros autores10,17, considerándose factores de mal pronóstico en pacientes con CPT5.

Se ha indicado que las discrepancias en el valor pronóstico de BRAFT1799A entre los diferentes estudios podrían deberse a la inclusión de diferentes subtipos histológicos de cáncer de tiroides, en las cuales la mutación BRAFT1799A se encontraría con mayor frecuencia en CPT que muestran arquitectura papilar (CPT-clásico, CPT-células altas, CPT-Warthin, microCPT), especialmente elevada en la variante más agresiva del CPT, la de células altas (55-100%)18,19, y sería relativamente baja (7-25%) en la variante folicular8,11,16–18,20,21. Para comprobar que los resultados obtenidos no estaban influidos por el subtipo histológico, en este estudio el análisis de la relación entre la presencia de la mutación BRAFT1799A y las características clinicopatológicas más importantes (metástasis linfáticas y a distancia, extensión peritiroidea, multifocalidad, tamaño tumoral, recidiva, persistencia) se planteó estratificando por variante histológica, lo que no generó diferencias significativas en cuanto a la distribución de la presencia de la mutación BRAFT1799A en ninguna de las variables analizadas. Esto puede deberse a que estos pacientes presentaron prácticamente la misma prevalencia de la mutación BRAFT1799A en los subtipos clásico y folicular (que en conjunto constituyen el 60% de los pacientes del estudio).

También se ha indicado que la ausencia de asociación estadística en algunos estudios puede deberse a la selección de una muestra demasiado pequeña, o heterogénea en cuestiones de tratamiento, diagnóstico o insuficiente tiempo de seguimiento de los pacientes. En nuestra serie se han analizado 97 pacientes con CPT. Al recoger todos los pacientes disponibles en el período de estudio, se representan fielmente las características clínicas e histopatológicas de los pacientes diagnosticados de CPT en nuestro hospital. La frecuencia de distribución de hallazgos patológicos (tamaño tumoral, metástasis nodulares, estadio, multifocalidad, etc.) se encuentra en consonancia con otros estudios publicados3,22. De hecho, la edad media en el momento del diagnóstico, la relación varón/mujer, el tamaño tumoral medio, multifocalidad, prevalencia de metástasis ganglionares durante el seguimiento y la metástasis a distancia en el momento del diagnóstico o durante el seguimiento, la recidiva y la estadificación tumoral, se encuentran dentro de los límites registrados en las mayores series de CPT3,22,23. El número de muestras procesadas por tumor, el manejo clínico uniforme de los pacientes (tratados por el mismo equipo) y el prolongado seguimiento (mediana de seguimiento de 64 meses) son un argumento en contra de desviación asimétrica de la recogida de datos clinicopatológicos.

No encontramos asociación entre la mutación BRAFT1799A y la aparición de metástasis ganglionares en el momento del diagnóstico, descrita por muchos autores10,17, incluido un metaanálisis15. Esta falta de uniformidad probablemente refleja el hecho de que la disección de cuello puede ser variable en los diferentes pacientes y estudios.

Ya que las metástasis a distancia del CPT son infrecuentes, particularmente en pacientes adultos, pocos estudios han presentado suficiente número de casos para poder encontrar una asociación significativa10,16. En nuestro caso, con solamente 3 pacientes con metástasis a distancia en el momento del diagnóstico, y sólo uno positivo para la mutación BRAFT1799A, esta relación tampoco aparece (tabla 2).

En el presente estudio no se encontró asociación de la presencia de la mutación BRAFT1799A con características histológicas (invasión extratiroidea, multifocalidad, invasión capsular, invasión vascular, necrosis tumoral o actividad mitótica). Otros investigadores han encontrado asociación entre la invasión extratiroidea y la mutación BRAFT1799A10,11,15,17,19,20,24, aunque el análisis multivariante estratificado por subtipo histológico hizo perder la asociación para algunos18,24. Otros autores no encuentran ninguna asociación10,16,25,26. La asociación de la mutación BRAFT1799A con multifocalidad del tumor e invasión vascular se ha descrito en pocos estudios17,18,25.

No pudimos obtener información acerca de multifocalidad, invasión vascular y capsular, necrosis tumoral y actividad mitótica en todos nuestros pacientes, ya que estos datos no se encontraban disponibles. Debido a este hecho, no se puede descartar la posibilidad de haber perdido significación estadística en las asociaciones de la mutación BRAFT1799A con esos parámetros.

Aunque la mayoría de los estudios discutidos anteriormente apoyan la existencia de una asociación entre la mutación BRAFT1799A y los factores clinicopatológicos clásicos de riesgo alto, algunos estudios no han conseguido obtener una asociación significativa10. De nuevo, no hay una explicación definitiva para esta inconsistencia de resultados, aunque algunos de los factores que pueden haber contribuido son el relativamente pequeño número de casos en algunos estudios «negativos» (en algunos de los cuales se observa una tendencia de la asociación sin alcanzar relevancia estadística), así como variaciones en la extensión de la enfermedad en el momento del diagnóstico inicial (por ejemplo, un CPT en un estadio temprano con pequeño tamaño tumoral tiene menos probabilidad de estar asociado a características patológicas agresivas), en el nivel de detalle de la descripción patológica y en los criterios diagnósticos, particularmente para definir los diversos subtipos de CPT, usados por diferentes patólogos9.

El valor predictivo de la mutación BRAFT1799A para recidiva de CPT se ha investigado en pacientes de diversos orígenes étnicos y geográficos de todo el mundo10, y muestra una clara asociación en algunos de ellos16,19–21,24-26, con una OR para persistencia y recidiva de CPT que oscila entre 1,91 y 5,4027. Para poder observar la recidiva de tumores con velocidad de crecimiento lenta, es fundamental el tiempo de seguimiento. En este estudio, los 97 pacientes contaban con un mínimo de 15 meses de seguimiento, y la mediana de seguimiento (64,1 meses) es relativamente larga, encontrándose entre los cuatro estudios con un período de seguimiento más largo de la bibliografía16,25,26,28. La aparición de recidiva tumoral en nuestros pacientes no se encontró estadísticamente asociada con la presencia de la mutación BRAFT1799A en el tumor primario. De hecho, se produjo una tendencia a presentar menos recidiva en los pacientes BRAFT1799A positivos (9/45; 20,0%) que en los negativos (13/52; 25,0%) (tabla 3). La estratificación por subtipo histológico no generó ninguna diferencia significativa en cuanto a la distribución de la presencia de la mutación BRAFT1799A en pacientes con o sin recidiva.

La presencia de la mutación BRAFT1799A en el tumor primario de estos pacientes tampoco se encontró asociada a la necesidad de nuevos tratamientos ablativos con I131 o de otras intervenciones quirúrgicas debidas a la aparición de metástasis (tabla 3).

En resumen, atendiendo a los hallazgos obtenidos en nuestra investigación, la presencia de la mutación BRAFT1799A no constituye un factor predictivo de recidiva de CPT.

En cuanto al valor pronóstico de la mutación BRAFT1799A para persistencia de la enfermedad, hay pocos estudios con un tiempo de seguimiento relativamente largo que hayan analizado la activación del oncogén braf y el desenlace de los pacientes de CPT: 6 años16,28, 7,3 años26, 11,7 años21 y 15 años25, con resultados discrepantes, encontrando asociación en 3 de ellos16,25,26. En la serie de Elisei et al25, con un seguimiento medio de 15 años, el más largo hasta el momento, la mutación BRAFT1799A actúa como un factor independiente de mal pronóstico para persistencia de CPT y menor supervivencia. En el presente estudio, con una mediana de seguimiento de 5,3 años, no se ha observado una relación entre la mutación BRAFT1799A y el desenlace del paciente. Ninguno de los pacientes falleció a causa del CPT. El 14,5% de los 76 pacientes que seguimos más de 27 meses (11/76) mostraba enfermedad tiroidea al final del período de estudio (tabla 3). Aunque este porcentaje es equiparable al descrito en el estudio de Elisei et al25, donde la persistencia de enfermedad es mucho mayor en pacientes braf positivos (braf positivo del 21,1% frente a braf negativo del 7,8%)25, en nuestros pacientes la distribución de la mutación BRAFT1799A en el grupo de enfermos se encuentra más equilibrada (braf positivo del 17,6% frente a braf negativo del 11,9%). En nuestro studio, se consideraron libres de enfermedad los pacientes sometidos a tiroidectomía total o casi total y ablación tiroidea de los restos remanentes, cuando no mostraban evidencia clínica ni iconográfica del tumor (detectable principalmente en ecografía del cuello o RCT corporal total durante el seguimiento), y los niveles de Tg eran indetectables en supresión y estimulación de TSH sin niveles de anticuerpos anti-Tg que interfirieran en su valoración. Así, 8 de los pacientes considerados en remisión presentaban concentraciones positivas de anticuerpos anti-Tg asociados a ecografías negativas, por lo que finalmente se consideraron libres de enfermedad. Como limitación de este estudio, la definición de ausencia de enfermedad se encuentra ligada a la propia sensibilidad de las técnicas bioquímicas y de imagen establecidas para el manejo del paciente con cáncer diferenciado de tiroides. Otra limitación del estudio, inherente a su propio diseño, donde los pacientes se han incluido secuencialmente en la cohorte, es que no se detectara persistencia o recidiva en los pacientes de menor tiempo de seguimiento, porque ésta puede aparecer después del período de estudio.

La terapia ablativa de tejido remanente con I131 se recomienda en pacientes con metástasis a distancia, extensión extratiroidea, o tamaño mayor de 4cm, así como en pacientes seleccionados con tumores de menor tamaño que presenten características de mayor riesgo29. Su uso está establecido por facilitar la detección temprana de recurrencia, facilitar la estadificación inicial, al identificar enfermedad previamente no diagnosticada, y por poder ser considerada una terapia adyuvante tras la cirugía en pacientes con riesgo de recurrencia o mortalidad. Sin embargo, el cáncer de tiroides puede perder la avidez por I131, una causa principal del fracaso del tratamiento con I131 y de la morbilidad y mortalidad asociadas30. La asociación entre la presencia de la mutación BRAFT1799A en el tumor primario y la pérdida de avidez por I131 en el tumor recurrente se ha descrito en varios estudios8,11, en los que se refieren tratamientos más agresivos para la recidiva de CPT, mayor persistencia de enfermedad y fracaso del tratamiento para la recidiva tumoral en los pacientes con tumores primarios positivos para la mutación BRAFT1799A.

En el presente estudio, no se encontró asociación entre el estado de BRAFT1799A y la recidiva tumoral, ni tampoco con la necesidad de nuevos tratamientos ablativos con I131 o de dosis mayores de I131. El porcentaje de pacientes positivos para la mutación BRAFT1799A que necesitó más de una dosis de tratamiento con I131 fue inferior a la de los negativos (el 15,6 frente al 21,2%; tabla 4), aunque esta diferencia no resultó estadísticamente significativa. Tampoco se encontraron diferencias en las dosis iniciales o totales de I131 recibidas por los pacientes incluidos en el estudio, en función de la presencia de la mutación BRAFT1799A en el tumor primario.

Al igual que en la serie de Riesco-Eizaguirre et al11, en la que el 66,7% (6/9) de los pacientes positivos para BRAFT1799A presentaba rastreos negativos en el momento de la recidiva, el 75% de nuestros pacientes BRAFT1799A positivos (3/4; tabla 6) presentaba un rastreo corporal total negativo, aunque esta tendencia no alcanzó significación estadística, presumiblemente debido al pequeño número de casos.

Ya que en este estudio se ha analizado la presencia de la mutación BRAFT1799A solamente en el tumor primario, no podemos conocer si los pacientes con rastreos positivos o negativos correspondían a metástasis positivas o negativas para el estado de la mutación BRAFT1799A. Habría sido interesante estudiar el estado de la mutación BRAFT1799A en el tejido de las metástasis que no captaron I131 en el rastreo corporal total, de haberse procedido a su exéresis.

Conclusiones generales

Los datos del presente estudio confirman la asociación entre la mutación BRAFT1799A y algunos de los parámetros clinicopatológicos hallados por otros autores, en lo que se refiere al tamaño tumoral, en especial a partir de 1cm, y a una edad superior a 60 años10,11,16,18,19,26,28.

Sin embargo, de nuestros resultados no puede inferirse que la mutación BRAFT1799A confiera un comportamiento o fenotipo más agresivo, reflejado en características histopatológicas de mayor riesgo, como multifocalidad, invasión capsular/vascular, extensión extratiroidea, etc., así como presencia de metástasis regionales o a distancia en el momento del diagnóstico del CPT, ni un mayor riesgo de recidiva tumoral o persistencia de enfermedad en los pacientes de CPT. Por tanto, a pesar de la corriente de opinión a favor de la asociación de la mutación BRAFT1799A con un peor pronóstico de CPT, todavía hay discrepancias en los diferentes estudios que obligan a que la toma de decisiones basada en el estado mutacional de BRAFT1799A deba ser considerada cuidadosamente.

Conflicto de intereses

Los autores del estudio declaran no tener conflicto de interés.

Agradecimientos

Los autores quisieran agradecer a Antonia Moreno Casares la colaboración prestada en el manejo del secuenciador ABI PRISM 3130xl Genetic Analyzer.

Bibliografía
[1]
National Cancer Institute [portal en internet]. Bethesda, MD; SEER Cancer Statistics Review, 1975-2007 [actualizado 2010; citado el 16 de septiembre de 2010]. Disponible en: http://seer.cancer.gov/statfacts/html/thyro.html#incidence-mortality
[2]
A.Y. Chen, A. Jemal, E.M. Ward.
Increasing incidence of differentiated thyroid cancer in the United States, 1988-2005.
Cancer., 115 (2009), pp. 3801-3807
[3]
S.A. Hundahl, I.D. Fleming, A.M. Fremgen, H.R. Menck.
A National Cancer Data Base report on 53,856 cases of thyroid carcinoma treated in the U.S., 1985-1995.
Cancer., 83 (1998), pp. 2638-2648
[4]
E.L. Mazzaferri, R.T. Kloos.
Clinical review 128: Current approaches to primary therapy for papillary and follicular thyroid cancer.
J Clin Endocrinol Metab., 86 (2001), pp. 1447-1463
[5]
L. Duntas, B.M. Grab-Duntas.
Risk and prognostic factors for differentiated thyroid cancer.
Hell J Nucl Med., 9 (2006), pp. 156-162
[6]
C. Zafon, G. Obiols.
Vía de señalización dependiente de la proteincinasa de activación mitogénica en el carcinoma papilar de tiroides. De las bases moleculares a la práctica clínica.
Endocrinol Nutr, 56 (2009), pp. 176-186
[7]
H. Davies, G.R. Bignell, C. Cox, P. Stephens, S. Edkins, S. Clegg, et al.
Mutations of the BRAF gene in human cancer.
Nature., 417 (2002), pp. 949-954
[8]
M. Xing.
BRAF mutation in thyroid cancer.
Endocr Relat Cancer., 12 (2005), pp. 245-262
[9]
M. Xing.
BRAF mutation in papillary thyroid cancer: pathogenic role, molecular bases, and clinical implications.
Endocr Rev., 28 (2007), pp. 742-762
[10]
S. Lassalle, V. Hofman, M. Ilie, C. Butori, A. Bozec, J. Santini, et al.
Clinical impact of the detection of BRAF mutations in thyroid pathology: potential usefulness as diagnostic, prognostic and theragnostic applications.
Curr Med Chem., 17 (2010), pp. 1839-1850
[11]
G. Riesco-Eizaguirre, P. Gutiérrez-Martínez, M.A. García-Cabezas, M. Nistal, P. Santisteban.
The oncogene BRAF V600E is associated with a high risk of recurrence and less differentiated papillary thyroid carcinoma due to the impairment of Na+/I- targeting to the membrane.
Endocr Relat Cancer., 13 (2006), pp. 257-269
[12]
E. Puxeddu, S. Moretti.
Clinical prognosis in BRAF-mutated PTC.
Arq Bras Endocrinol Metabol., 51 (2007), pp. 736-747
[13]
Y. Cohen, N. Goldenberg-Cohen, P. Parrella, I. Chowers, S.L. Merbs, J. Pe’er, et al.
Lack of BRAF mutation in primary uveal melanoma.
Invest Ophthalmol Vis Sci., 44 (2003), pp. 2876-2878
[14]
Y. Cohen, M. Xing, E. Mambo, Z. Guo, G. Wu, B. Trink, et al.
BRAF mutation in papillary thyroid carcinoma.
J Natl Cancer Inst., 95 (2003), pp. 625-627
[15]
J.H. Lee, E.S. Lee, Y.S. Kim.
Clinicopathologic significance of BRAF V600E mutation in papillary carcinomas of the thyroid: a meta-analysis.
Cancer., 110 (2007), pp. 38-46
[16]
E. Kebebew, J. Weng, J. Bauer, G. Ranvier, O.H. Clark, Q.Y. Duh, et al.
The prevalence and prognostic value of BRAF mutation in thyroid cancer.
Ann Surg., 246 (2007), pp. 466-470
[17]
F. Basolo, L. Torregrossa, R. Giannini, M. Miccoli, C. Lupi, E. Sensi, et al.
Correlation between the BRAF V600E mutation and tumor invasiveness in papillary thyroid carcinomas smaller than 20 millimeters: analysis of 1060 cases.
J Clin Endocrinol Metab., 95 (2010), pp. 4197-4205
[18]
C. Lupi, R. Giannini, C. Ugolini, A. Proietti, P. Berti, M. Minuto, et al.
Association of BRAF V600E mutation with poor clinicopathological outcomes in 500 consecutive cases of papillary thyroid carcinoma.
J Clin Endocrinol Metab., 92 (2007), pp. 4085-4090
[19]
M. Xing, W.H. Westra, R.P. Tufano, Y. Cohen, E. Rosenbaum, K.J. Rhoden, et al.
BRAF mutation predicts a poorer clinical prognosis for papillary thyroid cancer.
J Clin Endocrinol Metab., 90 (2005), pp. 6373-6379
[20]
G. Oler, J.M. Cerutti.
High prevalence of BRAF mutation in a Brazilian cohort of patients with sporadic papillary thyroid carcinomas: correlation with more aggressive phenotype and decreased expression of iodide-metabolizing genes.
Cancer., 115 (2009), pp. 972-980
[21]
A.M. Costa, A. Herrero, M.F. Fresno, J. Heymann, J.A. Alvarez, J. Cameselle-Teijeiro, et al.
BRAF mutation associated with other genetic events identifies a subset of aggressive papillary thyroid carcinoma.
Clin Endocrinol (Oxf)., 68 (2008), pp. 618-634
[22]
S.A. Hundahl, B. Cady, M.P. Cunningham, E. Mazzaferri, R.F. McKee, J. Rosai, et al.
Initial results from a prospective cohort study of 5583 cases of thyroid carcinoma treated in the united states during 1996. U.S. and German Thyroid Cancer Study Group. An American College of Surgeons Commission on Cancer Patient Care Evaluation study.
Cancer, 89 (2000), pp. 202-217
[23]
A. Rouxel, G. Hejblum, M.O. Bernier, P.Y. Boëlle, F. Ménégaux, G. Mansour, et al.
Prognostic factors associated with the survival of patients developing loco-regional recurrences of differentiated thyroid carcinomas.
J Clin Endocrinol Metab., 89 (2004), pp. 5362-5368
[24]
M. Xing, D. Clark, H. Guan, M. Ji, A. Dackiw, K.A. Carson, et al.
BRAF mutation testing of thyroid fine-needle aspiration biopsy specimens for preoperative risk stratification in papillary thyroid cancer.
J Clin Oncol., 27 (2009), pp. 2977-2982
[25]
R. Elisei, C. Ugolini, D. Viola, C. Lupi, A. Biagini, R. Giannini, et al.
BRAF(V600E) mutation and outcome of patients with papillary thyroid carcinoma: a 15-year median follow-up study.
J Clin Endocrinol Metab., 93 (2008), pp. 3943-3949
[26]
T.Y. Kim, W.B. Kim, Y.S. Rhee, J.Y. Song, J.M. Kim, G. Gong, et al.
The BRAF mutation is useful for prediction of clinical recurrence in low-risk patients with conventional papillary thyroid carcinoma.
Clin Endocrinol (Oxf)., 65 (2006), pp. 364-368
[27]
M. Xing.
Prognostic utility of BRAF mutation in papillary thyroid cancer.
Mol Cell Endocrinol., 321 (2010), pp. 86-93
[28]
L. Fugazzola, E. Puxeddu, N. Avenia, C. Romei, V. Cirello, A. Cavaliere, et al.
Correlation between B-RAFV600E mutation and clinico-pathologic parameters in papillary thyroid carcinoma: data from a multicentric Italian study and review of the literature.
Endocr Relat Cancer., 13 (2006), pp. 455-464
[29]
D.S. Cooper, G.M. Doherty, B.R. Haugen, R.T. Kloos, S.L. Lee, S.L. Mandel, et al.
American Thyroid Association (ATA) Guidelines Taskforce on Thyroid Nodules and Differentiated Thyroid Cancer, Revised American Thyroid Association management guidelines for patients with thyroid nodules and differentiated thyroid cancer.
Thyroid, 19 (2009), pp. 1167-1214
[30]
K.B. Ain.
Management of undifferentiated thyroid cancer.
Baillières Best Pract Res Clin Endocrinol Metab., 14 (2000), pp. 615-629
Copyright © 2010. SEEN
Opciones de artículo
Herramientas
es en pt

¿Es usted profesional sanitario apto para prescribir o dispensar medicamentos?

Are you a health professional able to prescribe or dispense drugs?

Você é um profissional de saúde habilitado a prescrever ou dispensar medicamentos

es en pt
Política de cookies Cookies policy Política de cookies
Utilizamos cookies propias y de terceros para mejorar nuestros servicios y mostrarle publicidad relacionada con sus preferencias mediante el análisis de sus hábitos de navegación. Si continua navegando, consideramos que acepta su uso. Puede cambiar la configuración u obtener más información aquí. To improve our services and products, we use "cookies" (own or third parties authorized) to show advertising related to client preferences through the analyses of navigation customer behavior. Continuing navigation will be considered as acceptance of this use. You can change the settings or obtain more information by clicking here. Utilizamos cookies próprios e de terceiros para melhorar nossos serviços e mostrar publicidade relacionada às suas preferências, analisando seus hábitos de navegação. Se continuar a navegar, consideramos que aceita o seu uso. Você pode alterar a configuração ou obter mais informações aqui.