Buscar en
Annals of Hepatology
Toda la web
Inicio Annals of Hepatology The effects of hyperthermia on human hepatocellular carcinoma stem and mature ca...
Journal Information
Vol. 19. Issue 3.
Pages 265-268 (May - June 2020)
Share
Share
Download PDF
More article options
Visits
206
Vol. 19. Issue 3.
Pages 265-268 (May - June 2020)
Original article
DOI: 10.1016/j.aohep.2019.12.006
Open Access
The effects of hyperthermia on human hepatocellular carcinoma stem and mature cancer cells
Visits
...
David Sontaga, David A. Milesa, Julia Uhanovaa, Micah Grubert Van Iderstinea, Jiaqi Yanga, Gerald Y. Minuka,b,
Corresponding author
gerald.minuk@umanitoba.ca

Corresponding author.
a Section of Hepatology, Department of Medicine, Rady College of Medicine, University of Manitoba, Winnipeg, Manitoba, Canada
b Department of Pharmacology and Therapeutics, Rady College of Medicine, University of Manitoba, Winnipeg, Manitoba, Canada
Article information
Abstract
Full Text
Bibliography
Download PDF
Statistics
Figures (2)
Abstract
Introduction and objectives

Hepatocellular carcinoma (HCC) can recur following radiofrequency ablation and other hyperthermic treatment modalities. Cancer stem cells (CSCs) are a subpopulation of HCC cells that are difficult to eradicate and largely responsible for tumor recurrences. Thus, the principal objective of this study was to determine whether human HCC CSCs are relatively thermal-resistant compared to non-stem or mature cancer cells (MCCs).

Materials and methods

Epithelial cell adhesion molecule (EpCAM) positive enriched CSCs and EpCAM MCCs were derived from a human HCC cell line using fluorescence activated cell sorting. Each cell population was exposed to 65°C heat for 0–16min and survival documented at various time points.

Results

Cell survival curves were similar in CSC and MCCs throughout the 16min heat exposure period. Maximum killing was obtained after 12–14min of heat exposure. Cytoprotective, heat shock proteins-70 (HSP70) and -90 (HSP90) mRNA expression were not disproportionately increased in CSCs.

Conclusions

These results suggest that human HCC CSCs are not more thermal resistant than MCCs and therefore, do not support the hypothesis that HCC recurrences following hyperthermic treatment reflect CSC thermal-resistance.

Keywords:
Hepatocellular carcinoma
Radiofrequency ablation
Cancer stem cells
Heat shock protein
Recurrence
Abbreviations
HCC

hepatocellular carcinoma

CSC

scancer stem cells

MCC

smature cancer cells

EpCAM

epithelial cell adhesion molecule

HSP

heat shock proteins

HSP70

heat shock proteins-70

HSP90

heat shock proteins-90

RFA

radiofrequency ablation

CT

cycle threshold

Full Text
1Introduction and objectives

Hepatocellular carcinoma (HCC) is one of the leading causes of cancer related death in the world today [1]. Unfortunately, potentially curative therapeutic options for HCC continue to be limited to liver transplantation, surgical resection and for small tumors; hyperthermic ablation.

There are various types of hyperthermic techniques presently available including radiofrequency (RFA), microwave and laser ablations [2]. Each technique is designed to achieve the same goals; induce irreversible cellular damage and create sufficient intra-tumor heat to coagulate tumor-feeding blood vessels. The heat generated by each modality varies between 60–100°C. Typical application times are relatively short (5–15min) and depend on the ablative technique employed, patient tolerance and operator experience [2]. However, despite suggested application times, tumor-site recurrences continue to occur in 5–20% of treated HCC patients [3].

Cancer stem cells (CSCs) are a small, subpopulation of tumor cells that possess the ability to self-replicate and differentiate into various cellular lineages [4]. They can be identified by the expression of certain stem cell surface markers including epithelial cell adhesion molecule (EpCAM). CSCs tend to be refractory to chemo- and radiation-therapy and thereby, play an important role in tumor recurrences. Indeed, it has been demonstrated that a single, viable CSC can be responsible for tumor development and/or recurrence [4]. Whether CSCs derived from HCC are more, less, or equally susceptible to hyperthermic ablation relative to non-CSC, mature cancer cells (MCCs) has yet to be determined.

Heat shock proteins (HSP) are a family of proteins produced by normal and cancer cells in response to stressful conditions including excess heat [5]. They are classified according to their molecular weight (HSP70, HSP90, etc.). By stabilizing new proteins and refolding proteins damaged by cell stress, HSPs protect cells from injury and death [5]. HSP70 and HSP90 are two of the more extensively studied HSPs. Both play important roles in maintaining hepatocyte viability under stressful conditions and resistance to HCC treatment [6–8].

In this study, we hypothesized that HCC recurrences following hyperthermic ablations occur as a result of CSC thermal-resistance relative to MCCs. Thus, the principal objective was to document and compare CSC and MCC susceptibilities to hyperthermia over a therapeutic time interval. A secondary objective was to determine whether HSP70 and/or HSP90 expression differ in CSCs and MCCs following heat exposure.

2Materials and methods2.1Cell culture

HepG2 cells were grown and cultured in DMEM supplemented with 10% heat inactivated fetal bovine serum (1248-028, Gibco) supplemented with 10U/ml Penstrep (15140-122, Gibco) and 2mM Glutamine (25030-081, Gibco). Cells were passaged every 3–4 days and allowed to proliferate to no more than 75% confluency in 752cm flasks (90076, FroggaBio Inc.) until sufficient for a given experiment.

2.2Cell sorting

Cells were washed twice with PBS-CMF (21600-10, Gibco) and 1ml trypsin-EDTA (25300-054, Gibco) and added to 752cm culture flasks. After a digestion period of 1–2min, cells were removed and 9ml of ice cold DMEM containing 10% HI-FBS was added. Cells were then gently washed off the flask with pipetting. Media was collected in 50ml conical tubes and centrifuged at 4°C for a period of 5min at 100×G. Supernatants were removed and cells resuspended in cell sorting buffer (PBS-CMF containing 2mM EDTA (ED2SC, Sigma), 1% FBS and 25mM HEPES (H4034, Sigma) pH 7.0, PBS-CMF). Cells were then exposed to anti human EpCAM (130-113-263, Miltenyi Biotech) tagged with FITC as well as 7-AAD (A07704, Beckman Coulter) as a marker of cell death, as per the manufacturer's recommended concentrations. Cells were sorted by FACS into two groups (EpCAM positive enriched or negative groups) in tubes containing 25% HI FBS in DMEM to a maximum dilution of 10% FBS. After sorting, cells were centrifuged at 100xG for 5min and resuspended to a concentration of 60K cells per ml and plated on 96 well plates (92696, FroggaBio Inc.) at a density of 6000 cells per well (i.e. 100μl per well). The first row received 10% of the total number of cells and last row no cells in order to serve as references. Cells were then cultured for 24h in a 5% CO2 incubator maintained at 37°C. We have previously reported that EpCAM positive enriched cells isolated by this technique possess the CSC features of self-renewal, diverse lineage differentiation and spheroid/colony formation in anchor free media [9].

2.3Heat treatment

Heating blocks were heated to the desired temperature of 65°C for at least 1h prior to use. Plates were then placed overhanging on the heating block such that lanes 1 and 2 were not in contact with the block and the timer started. Plates were shifted on the block one row at a time after 1, 2, 4, 5, 6, 8, 10, 12, 14 and 16min and then placed in an incubator and after 24h, assayed for WST-1 activity as an indicator of cell survival.

2.4HSP70 and HSP90 determinations

In a separate series of experiments employing the same apparatus and technique, cells were harvested after eight minutes heat exposure and HSP mRNA expression documented by real-time quantitative RT-PCR with the HSP70 primer set 5’-AGGCCGACAAGAAGAAGGTGCT-3’ (forward) and 5’-TGGTACAGTCCGCTGATGATGG-3’ (reverse) and HSP90: 5’-TGGTCATTGTGCGGTTCTCT (reverse) and 5’-AGAGAACCGCACAATGACCA-3’ (forward). All PCR reactions were performed in a ViiA™ 7 Real Time PCR System (Applied Bio-Systems, USA), with the SYBR Green PCR Core Reagent under the following conditions: 1 cycle at 95°C for 10min, 35 cycles at 95°C for 15s, annealing temperature at 58°C for 1min. Data were analyzed by QuantStudio™ Real Time PCR Software (Applied Bio-Systems, USA). Real-time detection of the emission gene cycle threshold (CT) values of the targets was standardized to the beta-actin housekeeping gene: TCCTCTCCCAAGTCCACACAGG (forward) GGGCACGAAGGCTCATCATTC (reverse). Gene expressions were calculated by using the relative quantification method (2−ΔCT) (PMID: 11846609). Experiments were performed in triplicate on a minimum of three occasions.

3Results

The effects of heat exposure on EpCAM+ CSC and EpCAM MCCs are provided in Fig. 1. There were no differences in survival throughout the 16min heat exposure period in the two cell populations and maximum cell killing was obtained after 12–14min of heat exposure. In separate experiments where culture conditions were restored after the 16min of heat exposure for an additional 72h, no growth of cells was observed.

The results of HSP70 and HSP90 mRNA expression after eight minutes of heat exposure in CSCs versus MCCs are provided in Fig. 2. HSP-70 expression increased in both cell populations (2.14±1.20 and 3.22±2.57 fold respectively) but were not disproportionately upregulated in CSCs. HSP-90 expression actually decreased (0.61±0.25 and 0.60±0.15 fold respectively) in both cell populations following heat exposure.

4Discussion

The results of this study do not support the hypothesis that HCC site recurrences following hyperthermic ablation reflect relative CSC thermal-resistance. Specifically, the survival curve in CSCs was similar to that obtained with MCCs throughout the 16min of exposure to 65°C. That HSP70 and HSP90 mRNA expression were not disproportionately increased in CSCs further argues against the hypothesis.

An important question that emerges from this study is whether the recommended duration of heat exposure with thermal ablation is optimal to obtain complete cell killing. Unfortunately, there are no consistent guidelines as to how long hyperthermic ablations should be applied to HCC tumor tissues. Published literature and device manufacturers suggest 10–15min for small electrode RFA, shorter if the device “impedes out” at an earlier time point or in the setting of severe patient discomfort [2,10]. For microwave ablations, the most common recommended application time is 5–10min and for laser ablation; 5min [11–14]. Thus, depending on the modality employed, many patients will have not received heat treatment for the 12–14min which may be required to obtain maximal cell killing. However, the impact of excess heat on tumor vessel integrity and tumor ischemia must also be taken into consideration as does the dissipation of heat from the point of electrode placement to the periphery of the tumor and progressive thermal injury that may occur hours or days following the application of heat.

Regardless of the cell type (CSC or MCC), the results of the HSP-70 analyses (2–3 fold increases) raise interesting therapeutic considerations in that specific and non-specific HSP inhibitors have been identified and are commercially available [15]. Whether pre-treatment with these agents will enhance the effects of thermal ablative therapies for HCC as described for breast cancer remains to be determined [16].

There are a number of limitations to this study that warrant emphasis. First, as mentioned above, because thermal ablation also interferes with tumor blood flow and denatures potentially important extracellular proteins, our in vitro findings should be interpreted with caution. Indeed, additional studies employing animal models of HCC are required to identify the optimal duration of heat application. Second, although a well-defined human HCC cell line rather than fresh HCC tissue served as the source of the cell populations (in order to maximize CSC enrichment), the possibility that a small percent of MCCs were EpCAM+ cannot be excluded. Third, there were too few surviving cells toward the end of heat exposure to determine whether those that survived longest were CSCs or MCCs. Fourth, although previous studies do not suggest a “dose-response” effect for temperatures beyond 60°C, the absolute intratumor temperatures achieved with the various hyperthermic techniques may influence optimal application times and this could not be addressed within the experimental design employed for this study. Finally, thermal treatment was limited to hyperthermia and cryo-ablation was not studied.

In conclusion, while the results of this study argue against relative CSC thermal resistance being responsible for HCC recurrences following hyperthermic treatments, preventing increases in HSP expression may represent a therapeutic strategy worthy of consideration.

Conflict of interest

The authors have no conflicts of interest to declare.

Acknowledgements

The authors wish to thank the Canadian Liver Foundation/Kenroc Builders Inc. for their support and Ms R. Vizniak for her prompt and accurate typing of the manuscript.

References
[1]
Y.A. Ghouri, I. Mian, J.H. Rowe.
Review of hepatocellular carcinoma: epidemiology, etiology, and carcinogenesis.
J Carcinog, 16 (2017), pp. 1
[2]
E. Naeem, S. Abid.
Ablative techniques in hepatocellular carcinoma treatment.
Hepatoma Res, 4 (2018), pp. 18
[3]
T. Hori, K. Nagata, S. Hasuike, M. Onaga, M. Motoda, A. Moriuchi, et al.
Risk factors for the local recurrence of hepatocellular carcinoma after a single session of percutaneous radiofrequency ablation.
J Gastroenterol, 38 (2003), pp. 977-981
[4]
H. Clevers.
The cancer stem cell: premises, promises and challenges.
Nat Med, 17 (2011), pp. 313-319
[5]
F.R. Sharp, S.M. Massa, R.A. Swanson.
Heat-shock protein protection.
Trends Neurosci, 22 (1999), pp. 97-99
[6]
B.P. Huang, C.S. Lin, C.J. Wang, S.H. Kao.
Upregulation of heat shock protein 70 and the differential protein expression induced by tumor necrosis factor-alpha enhances migration and inhibits apoptosis of hepatocellular carcinoma cell HepG2.
Int J Med Sci, 14 (2017), pp. 284-293
[7]
C. Wang, Y. Zhang, K. Guo, N. Wang, H. Jin, Y. Liu, et al.
Heat shock proteins in hepatocellular carcinoma: molecular mechanism and therapeutic potential.
Int J Cancer, 138 (2016), pp. 1824-1834
[8]
M. Chuma, M. Sakamoto, K. Yamazaki, T. Ohta, M. Ohki, M. Asaka, et al.
Expression profiling in multistage hepatocarcinogenesis: identification of HSP70 as a molecular marker of early hepatocellular carcinoma.
Hepatology, 37 (2003), pp. 198-207
[9]
J. Yang, Y. Gong, D.P. Sontag, I. Corbin, G.Y. Minuk.
Effects of low-density lipoprotein docosahexaenoic acid nanoparticles on cancer stem cells isolated from human hepatoma cell lines.
Mol Biol Rep, 45 (2018), pp. 1023-1036
[10]
J.P. McGahan, G.D. Dodd.
Radiofrequency ablation of the liver current status.
Am J Roentgenol, 176 (2001), pp. 3-16
[11]
W. Zhou, M. Liang, H. Pan, X. Liu, Y. Jiang, Y. Wang, et al.
Comparison of ablation zones among different tissues using 2450-MHz cooled-shaft microwave antenna: results in ex vivo porcine models.
[12]
N. Lucchina, D. Tsetis, A.M. Ierardi, F. Giorlando, E. Macchi, E. Kehagias, et al.
Current role of microwave ablation in the treatment of small hepatocellular carcinomas.
Ann Gastroenterol, 29 (2016), pp. 460-465
[13]
G.G. Di Costanzo, G. D’Adamo, R. Tortora, F. Zanfardino, S. Mattera, G. Francica, et al.
A novel needle guide system to perform percutaneous laser ablation of liver tumors using the multifiber technique.
Acta Radiol, 54 (2013), pp. 876-881
[14]
G.G. Di Costanzo, G. Francica, C.M. Pacella.
Laser ablation for small hepatocellular carcinoma: state of the art and future perspectives.
World J Hepatol, 6 (2014), pp. 704-715
[15]
S. Chatterjee, T.F. Burns.
Targeting heat shock proteins in cancer: a promising therapeutic approach.
[16]
C.H. Lee, H.M. Hong, Y.Y. Chang, W.W. Chang.
Inhibition of heat shock protein (Hsp) 27 potentiates the suppressive effect of Hsp90 inhibitors in targeting breast cancer stem-like cells.
Biochimie, 94 (2012), pp. 1382-1389
Copyright © 2020. Fundación Clínica Médica Sur, A.C.
Article options
Tools
es en pt

¿Es usted profesional sanitario apto para prescribir o dispensar medicamentos?

Are you a health professional able to prescribe or dispense drugs?

Você é um profissional de saúde habilitado a prescrever ou dispensar medicamentos

es en pt
Política de cookies Cookies policy Política de cookies
Utilizamos cookies propias y de terceros para mejorar nuestros servicios y mostrarle publicidad relacionada con sus preferencias mediante el análisis de sus hábitos de navegación. Si continua navegando, consideramos que acepta su uso. Puede cambiar la configuración u obtener más información aquí. To improve our services and products, we use "cookies" (own or third parties authorized) to show advertising related to client preferences through the analyses of navigation customer behavior. Continuing navigation will be considered as acceptance of this use. You can change the settings or obtain more information by clicking here. Utilizamos cookies próprios e de terceiros para melhorar nossos serviços e mostrar publicidade relacionada às suas preferências, analisando seus hábitos de navegação. Se continuar a navegar, consideramos que aceita o seu uso. Você pode alterar a configuração ou obter mais informações aqui.