Buscar en
Revista Argentina de Microbiología
Toda la web
Inicio Revista Argentina de Microbiología Fe de errores de «Viral diagnostic criteria for Feline immunodeficiency virus a...
Información de la revista
Vol. 53. Núm. 4.
Páginas 380 (Octubre - Diciembre 2021)
Compartir
Compartir
Descargar PDF
Más opciones de artículo
Vol. 53. Núm. 4.
Páginas 380 (Octubre - Diciembre 2021)
Fe de errores
Open Access
Fe de errores de «Viral diagnostic criteria for Feline immunodeficiency virus and Feline leukemia virus infections in domestic cats from Buenos Aires, Argentina» [Rev Argent Microbiol. 2016;48(4):293-297]
Erratum to «Viral diagnostic criteria for Feline immunodeficiency virus and Feline leukemia virus infections in domestic cats from Buenos Aires, Argentina» [Rev Argent Microbiol. 2016;48(4):293-297]
Visitas
...
Sabrina Galdo Novo, Danilo Bucafusco, Leandro M. Diaz, Ana Cristina Bratanich
Facultad de Ciencias Veterinarias, Universidad de Buenos Aires, Ciudad Autónoma de Buenos Aires, Buenos Aires, Argentina
Contenido relaccionado
Sabrina Galdo Novo, Danilo Bucafusco, Leandro M. Diaz, Ana Cristina Bratanich
Información del artículo
Texto completo
Descargar PDF
Estadísticas
Tablas (1)
Tabla 1. Primers used for FIV and FeLV n-PCRs. The reverse primer for FIV amplification was the same for both rounds
Texto completo

En el artículo publicado anteriormente, se han detectado dos errores en la secuencia de cebadores detallados en la página 3. Se reemplaza la tabla 1 por la siguiente:

Tabla 1.

Primers used for FIV and FeLV n-PCRs. The reverse primer for FIV amplification was the same for both rounds

  Forward  Reverse 
External and Internal round FIV  5’ GGCATATCCTATTCAAACAG 3’  5’ AAGAGTTGCATTTTATATCC 3’ 
Internal round FIV    5’ TCTGCTTGTTGTTCTTGAGT 3’ 
External round FeLVT  5’ AAAATTTAGCCAGCTACTGCAG 3’  5’ GAAGGTCGAACTCTGGTCAACT 3’ 
Internal round FeLV  5’ TTACTCAAGTATGTTCCCATG 3’  5’ CTGGGGAGCCTGGAGACTGC 3’ 
Copyright © 2016. Asociación Argentina de Microbiología
Opciones de artículo
Herramientas
es en pt

¿Es usted profesional sanitario apto para prescribir o dispensar medicamentos?

Are you a health professional able to prescribe or dispense drugs?

Você é um profissional de saúde habilitado a prescrever ou dispensar medicamentos