Buscar en
Revista Argentina de Microbiología
Toda la web
Inicio Revista Argentina de Microbiología Dicistroviridae: A new viral purification technique
Información de la revista
Vol. 49. Núm. 4.
Páginas 311-314 (Octubre - Diciembre 2017)
Compartir
Compartir
Descargar PDF
Más opciones de artículo
Visitas
815
Vol. 49. Núm. 4.
Páginas 311-314 (Octubre - Diciembre 2017)
Brief report
DOI: 10.1016/j.ram.2017.04.008
Open Access
Dicistroviridae: A new viral purification technique
Dicistroviridae: una nueva técnica de purificación viral
Visitas
...
María L. Susevicha,b,c,
Autor para correspondencia
marialaura@cepave.edu.ar

Corresponding author.
, Germán E. Metzb,c, Gerardo A. Martia,b,c, María G. Echeverríab,c
a Centro de Estudios Parasitológicos y de Vectores (CEPAVE-CCT-La Plata-CONICET-UNLP), Boulevard 120 entre 61 y 62, 1900 La Plata, Argentina
b CONICET (CCT-La Plata), La Plata, Argentina
c Virology, Faculty of Veterinary Sciences, National University of La Plata, La Plata, Argentina
Información del artículo
Resumen
Texto completo
Bibliografía
Descargar PDF
Estadísticas
Figuras (2)
Abstract

The family Dicistroviridae comprises three genera and about twenty species of RNA virus, most of them with health or agricultural importance. The Triatoma virus (TrV) is the only entomopathogenic virus identified in triatomine bugs up to the present. TrV replicates within the intestinal epithelial cells, causing high mortality rate and delayed development of the molt of these bugs. TrV has been proposed as a biological control agent for vectors of Chagas disease. Viral particles were purified from feces of 1, 5 and 10 insects from an experimental colony of Triatoma infestans infected with TrV. Viral concentration and infectivity were corroborated using polyacrylamide gels and RT-PCR, respectively. In this work we report a method of viral purification that allows to reduce necessary reagents and time, using a very small amount of fecal matter.

Keywords:
Dicistrovirus
RNA virus
Viral purification
Triatomines
Resumen

La familia Dicistroviridae está compuesta por tres géneros y casi una veintena de especies de virus ARN, la mayoría de ellas de importancia sanitaria o agrícola. Triatoma virus (TrV) es el único virus entomopatógeno identificado en triatominos hasta el momento. El TrV se replica en las células del epitelio intestinal; ello provoca una alta tasa de mortalidad y retraso en el desarrollo de la muda del insecto. Se ha propuesto la utilización de TrV como agente de control biológico para vectores de la enfermedad de Chagas. Las partículas virales fueron purificadas a partir de materia fecal de 1, 5 y 10 insectos obtenidos de una colonia experimental infectada con TrV de Triatoma infestans y se corroboró su concentración viral e infectividad mediante geles de poliacrilamida y RT-PCR, respectivamente. En este trabajo se reporta un método de purificación viral que permite la reducción de los reactivos y del tiempo necesario para lograr dicha purificación, partiendo de una mínima cantidad de materia fecal.

Palabras clave:
Dicistrovirus
Virus ARN
Purificación viral
Triatominos
Texto completo

The family Dicistroviridae includes three genera: Cripavirus, Aparavirus and Triatovirus, with almost twenty species, most of which have sanitary or agricultural importance3,6. The name of the family refers to the two open reading frames or cistrons (ORFs) that codify its viral genome, ORF1 and ORF2. Of these, ORF2 codes for structural proteins VP1, VP2, VP3 and VP4, whose masses in the case of Triatoma virus (TrV) are 29.7kDa, 28.4kDa, 32.8kDa and 5.5kDa, respectively1. These are naked viruses, with icosahedral symmetry, approx. 30nm in diameter and positive-sense single-strand RNA with 9010 nucleotides.

TrV, together with the Solenopsis invicta virus (SINV-1), are two members of this family that are pathogenic to medically important insects3. Due to its horizontal mode of transmission and high pathogenicity in triatomine populations, TrV has been proposed as a biological control agent for the vectors of Chagas disease9,10. Recently, this virus has been shown to be not infectious for mice and probably not for other vertebrates either, a finding that reinforces the possibility that it might be used as a tool for the biological control of triatominos12.

Up to the present, the purification protocols used for TrV have been based on the use of whole infected insects, their gut content, their intestines or pieces of paper with dry feces1,7,11. These techniques are time-consuming and not always provide good/high efficiency of recovery; thus, with the goal of optimizing the viral purification technique, this work proposes certain methodological modifications. Obtaining viral mass is of interest in order to enable recovery of viral particles to be used in further trials.

In this work we present a method for viral purification that allows to reduce the necessary time, using a minimal sample. This technique may be applied for TrV and might also be used for other members of the family Dicistroviridae.

Viral particles were purified from fecal matter obtained by abdominal compression of one, five and ten nymphs V from an experimental colony of Triatoma infestans infected with TrV. The insects were fed (10 days after molting into the 3rd stage) during 1h using a solution of human blood and viral proteins of 0.2mg/ml using an artificial feeder and kept at the Centro de Estudios Parasitológicos y de Vectores (CEPAVE), La Plata, Argentina8,9. The samples were identified as follows:

  • Sample 1 (M1): pooled fecal matter from 10 insects (0.0235g);

  • Sample 2 (M2): pooled fecal matter from 5 insects (0.0101g);

  • Sample 3 (M3): fecal matter from 1 insect (0.0035g).

Each sample was individually homogenized with 150μl of phosphate-buffered saline (PBS), stirred for 30s and centrifuged for 10min at 13000×g. The pellet was discarded and the supernatant was again centrifuged for 10min at 13000×g. After this second centrifugation, the supernatants of the samples used (M1, M2) were collected in two tubes for a third and last centrifugation along with M3 for 10min at 13000×g. In this manner, cell remains are discarded and only viral particles are obtained. The supernatant from each sample (M1: 1500μl; M2: 750μl and M3: 150μl) was seeded into three tubes in a continuous sucrose gradient (10–30%, w/v) and centrifuged for 3h at 30000×g at 4°C in a SW65 rotor (Beckman L8-80M Ultracentrifuge). Subsequently, fractions of 500μl from each tube were taken and preserved at −20°C. Twenty-five microliters of each fraction were seeded into 12.5% polyacrylamide gels to corroborate presence of the viral proteins. They were dyed with Coomassie blue and additionally a kit for silver staining (Pierce® Silver Stain Kit).

Later, positive fractions were quantified in 12.5% polyacrylamide gels using an albumin pattern as reference (25μl from each sample).

VP1 and VP2 two of the four structural proteins of TrV were detected by SDS-PAGE, (Fig. 1). According to the albumin pattern of the polyacrylamide gel used as reference, the following concentration results were obtained:

  • Sample 1 (M1): Approx. 30μg/ml;

  • Sample 2 (M2): Approx. 20μg/ml;

  • Sample 3 (M3): Approx. 5μg/ml.

Figure 1.

12.5% Polyacrylamide gel of the three samples separated electrophoretically stained with Pierce® Silver Stain Kit. Viral proteins VP1 (29.7kDa) and VP2 (28.4kDa) were indicated. Marker: Color Plus Protein Ladder Prestained (New England BioLabs).

(0,06MB).

To measure the viral activity from purified samples we performed a RT-PCR to detect the presence of infectious RNA using the following primer pairs: TrVA- 5′ TCAAAACTAACTATCATTCTGG 3′ and TrVB- 5′ TTCAGCCTTATTCCCCCCC 3′ with an expected product of 832bp (Fig. 2). RT-PCR was performed following the methodology proposed by Marti et al7.

Figure 2.

RT-PCR from purified samples (M1, M2 and M3) runned in a 1.5% agarose gel. L: 100bp Mass Ruler (Promega).

(0,17MB).

The total duration of the procedure described here is 7:30h; in comparison with other techniques for viral purification such as that described by Marti et al.7, which represents a 30% decrease in the total time required, reducing by 50% the time required for the clarification of macerates and dissection of insects. Although the purifications in ClCs used by Muscio et al.11 and Agirre et al.1, are useful to separate RNA-full from empty capsids, they imply adding one more day to the procedure duration.

With regard to procedure duration, obtaining viral particles from fecal matter is similar to using dry fecal buttons1. Starting from fecal matter or buttons allows to decrease contamination during clarification, given that intestinal contents and insect macerate contain lipids and cuticular remains that complicate the procedure. The positive bands obtained in the three samples by RT-PCR indicate infectious viral particles. The speed of our method using fresh fecal matter would allow the viral particles to still remain active and avoid sacrificing insects from the colony.

Up to the present, little is known about this viral family. However, the number of recorded instances of these viruses affecting insect with medical/sanitary and agricultural/economic importance is constantly increasing, and several authors have postulated them as biological control agents2–5,9,10,14.

The development of fast, reliable and inexpensive methods to diagnose TrV infection could be useful for future research applied to other Dicistrovirus. The problems that TrV may cause when introduced into insectaries through triatomine colonies are well known, as is its presence in insectaries in Argentina and Brazil8. This TrV purification procedure is advantageous because it avoids sacrificing the insect colony, currently the only known source of viral particles, and allows direct extraction from very small amounts of fecal matter. This is important because it is still difficult to obtain viral replication in diverse cell culture lines. Although Electron Microscopy (EM) is used for the detection of viral particles13, this is complicate because it requires access to an electron microscope and a good resolution for small particles. Furthermore, the latter technique may have poor sensitivity to low viral loads and requires costly equipment; therefore, it is not suitable for routine analyses.

It is essential to have an adequate (low-cost and fast) method for viral purification, and, compared with traditional methods, the technique proposed here is a good alternative to previously used ones7,11. This method is fast and efficient compared to other proposals, allowing the rapid extraction of a good amount of purified virus from a minimal amount of fecal matter7,11,13.

Ethical disclosuresProtection of human and animal subjects

The authors state that no human or animal experiments have been performed for this research.

Confidentiality of data

The authors state that they have followed the protocols of their work center on the publication of patient data.

Right to privacy and informed consent

The authors declare that no patient data appear in this article.

Conflict of interest

The authors declare that they have no conflicts of interest.

Acknowledgments

This work was partly funded by grants PIP N° 0007 (CONICET) and PICT N° 2014-1536 (ANPCyT). We thank the Virology Department, Facultad de Ciencias Veterinarias, Universidad Nacional de La Plata (UNLP), Argentina, and CEPAVE (Centro de Estudios Parasitológicos y de Vectores -CONICET-UNLP, Argentina) where this study was performed.

References
[1]
J. Agirre, K. Aloria, J.M. Arizmendi, I. Iloro, F. Elortza, R. Sánchez-Eugenia, G.A. Marti, E. Neumann, F.A. Rey, D.M. Guérin.
Capsid protein identification and analysis of mature Triatoma virus (TrV) virions and naturally occurring empty particles.
Virology, 409 (2011), pp. 91-101
[2]
L. Ban, A. Didon, L.M. Jonsson, R. Glinwood, G. Delp.
An improved detection method for the Rhopalosiphum padi virus (RhPV) allows monitoring of its presence in aphids and movement within plants.
J Virol Methods, 142 (2007), pp. 136-142
[3]
B.C. Bonning, W.A. Miller.
Dicistroviruses.
Ann Rev Entomol, 55 (2010), pp. 129-150
[4]
P.D. Christian, P.D. Scotti.
Picorna-like viruses of insects.
The insect viruses, pp. 301-336
[5]
A. Dombrovsky, N. Luria.
The Nerium oleander aphid Aphis nerii is tolerant to a local isolate of Aphid lethal paralysis virus (ALPV).
Virus Genes, 46 (2013), pp. 354-361
[6]
M.G. Echeverría, G.E. Metz, M.L. Susevich, A. Balsalobre, G.A. Marti.
Triatovirus: a new genus in the family Dicistroviridae.
ICTV (International Committee on Taxonomy of Viruses) 2015, (2016),
006a-eS. ISSN: 0304-8608 (print) 1432-8798
[7]
G. Marti, E.T. González, J.J. Garcia, A.R. Viguera, D.M.A. Guerin, M.G. Echeverría.
AC-ELISA and RT-PCR assays for the diagnosis of Triatoma virus (TrV) in triatomines (Hemiptera: Reduviidae) species.
Arch Virol, 153 (2008), pp. 1427-1432
[8]
G.A. Marti, M.G. Echeverría, M.L. Susevich, S. Ceccarelli, A. Balsalobre, J.E. Rabinovich, L. Diotaiuti, D.M.A. Guerin.
Exploration for Triatoma virus (TrV) infection in laboratory-reared triatominos of Latin America: a collaborative study.
Int J Trop Insect Sci, 33 (2013), pp. 294-304
[9]
G.A. Marti, A. Balsalobre, M.L. Susevich, J.E. Rabinovich, M.G. Echeverría.
Detection of Triatomine infection by Triatoma virus and horizontal transmission: protecting insectaries and prospects for biological control.
J Inverbr Pathol, 124 (2015), pp. 57-60
[10]
O.A. Muscio, J. La Torre, M.A. Bonder, E.A. Scodeller.
Triatoma virus pathogenicity in laboratory colonies of Triatoma infestans Hemiptera: Reduviidae.
J Med Entomol, 34 (1997), pp. 253-256
[11]
O.A. Muscio, J.L. La Torre, E.A. Scodeller.
Characterization of Triatoma virus, a picorna-like virus isolated from the triatomine bug Triatoma infestans.
J Gen Virol, 69 (1988), pp. 2929-2934
[12]
J.F. Querido, J. Agirre, G.A. Marti, D.M. Guérin, M.S. Silva.
Inoculation of Triatoma virus (Dicistroviridae: Cripavirus) elicits a non-infective immune response in mice.
Parasit Vectors, 15 (2013), pp. 66
[13]
G.S. Rozas-Dennis, N.J. Cazzaniga.
Effect of Triatoma virus (TrV) on fecundity and moulting in Triatoma infestans Hemiptera: Reduviidae.
Ann Trop Med Parasitol, 94 (2000), pp. 633-641
[14]
S. Toriyama, P.L. Guy, S. Fuji, M. Takahashi.
Characterization of a new picorna-like virus, himetobi P virus, in planthoppers.
J Gen Virol, 73 (1992), pp. 1021-1023
Copyright © 2017. Asociación Argentina de Microbiología
Opciones de artículo
Herramientas
es en pt

¿Es usted profesional sanitario apto para prescribir o dispensar medicamentos?

Are you a health professional able to prescribe or dispense drugs?

Você é um profissional de saúde habilitado a prescrever ou dispensar medicamentos

es en pt
Política de cookies Cookies policy Política de cookies
Utilizamos cookies propias y de terceros para mejorar nuestros servicios y mostrarle publicidad relacionada con sus preferencias mediante el análisis de sus hábitos de navegación. Si continua navegando, consideramos que acepta su uso. Puede cambiar la configuración u obtener más información aquí. To improve our services and products, we use "cookies" (own or third parties authorized) to show advertising related to client preferences through the analyses of navigation customer behavior. Continuing navigation will be considered as acceptance of this use. You can change the settings or obtain more information by clicking here. Utilizamos cookies próprios e de terceiros para melhorar nossos serviços e mostrar publicidade relacionada às suas preferências, analisando seus hábitos de navegação. Se continuar a navegar, consideramos que aceita o seu uso. Você pode alterar a configuração ou obter mais informações aqui.