Buscar en
Revista Argentina de Microbiología
Toda la web
Inicio Revista Argentina de Microbiología Caracterización de la variabilidad genética de cepas de campo de Brucella cani...
Información de la revista
Vol. 50. Núm. 3.
Páginas 255-263 (Julio - Septiembre 2018)
Compartir
Compartir
Descargar PDF
Más opciones de artículo
Visitas
1811
Vol. 50. Núm. 3.
Páginas 255-263 (Julio - Septiembre 2018)
ORIGINAL
DOI: 10.1016/j.ram.2017.07.006
Open Access
Caracterización de la variabilidad genética de cepas de campo de Brucella canis aisladas en Antioquia
Characterization of the genetic variability of field strains of Brucella canis isolated in Antioquia
Visitas
...
Juana L. Vidal Arboledaa,
Autor para correspondencia
luifernanda@gmail.com

Autor para correspondencia.
, Luisa F. Ortiz Romanb, Martha Olivera Angelb
a Grupo Vericel, Facultad de Ciencias Agrarias, Universidad de Antioquia, Medellín, Colombia
b Grupo Biogénesis, Facultad de Ciencias Agrarias, Universidad de Antioquia, Medellín, Colombia
Información del artículo
Resumen
Texto completo
Bibliografía
Descargar PDF
Estadísticas
Figuras (3)
Mostrar másMostrar menos
Tablas (2)
Tabla 1. Cebadores empleados para el análisis de las deleciones e inserciones observadas en la cepa Brucella canis str. Oliveri
Tabla 2. Genes usados como marcadores de especie
Mostrar másMostrar menos
Resumen

Brucella canis, un patógeno intracelular facultativo, es responsable de la brucelosis canina, una enfermedad zoonótica que afecta a los caninos y al hombre. En los primeros causa abortos y fallas reproductivas; en el ser humano genera síntomas inespecíficos. En el año 2005 se demostró la presencia de B. canis en Antioquia (Colombia). Las cepas halladas se identificaron como tipo 2. La secuenciación del genoma completo de una cepa de campo denominada Brucella canis str. Oliveri mostró indels específicos de especie; a partir de estos se buscó conocer características genómicas de las cepas de B. canis aisladas y establecer relaciones filogenéticas, así como el tiempo de divergencia de la cepa Oliveri. Se realizó PCR convencional y secuenciación de 30 cepas de campo, se identificaron 5 indels reconocidos en B. canis str. Oliveri, se empleó ADN de Brucella suis, Brucella melitensis y cepas vacunales de Brucella abortus como controles. Se determinó que las cepas de campo estudiadas comparten 4 de los 5 indels de la cepa Oliveri, lo que indica la presencia de más de una cepa de B. canis circulando en la región. El análisis filogenético se realizó con 24 cepas de Brucella mediante secuencias concatenadas de genes marcadores de especie. Se probó la hipótesis del reloj molecular y adicionalmente se realizó test de tasas relativas de Tajima. De esta manera se demostró que la cepa Oliveri, al igual que las otras cepas de B. canis analizadas, divergen de B. suis. Se rechazó la hipótesis del reloj molecular entre las especies de Brucella y se demostró una tasa de evolución y una distancia genética similar entre las cepas de B. canis.

Palabras clave:
Inserciones
Deleciones
Indels
Reloj molecular
Abstract

Brucella canis is a facultative intracellular pathogen responsible for canine brucellosis, a zoonotic disease that affects canines, causing abortions and reproductive failure; and the production of non-specific symptoms in humans. In 2005 the presence of B. canis in Antioquia was demonstrated and the strains were identified as type 2. The sequencing of the genome of a field strain denoted Brucella canis str. Oliveri, showed species-specific indel events, which led us to investigate the genomic characteristics of the B. canis strain isolated and to establish the phylogenetic relationships and the divergence time of B. canis str. Oliveri. Conventional PCR sequencing was performed in 30 field strains identifying 5 indel events recognized in B. canis str. Oliveri. ADN from Brucella suis, Brucella melitensis and vaccine strains from Brucella abortus were used as control, and it was determined that all of the studied field strains shared 4 out of the 5 indels of the sequenced Oliveri strain, indicating the presence of more than one strain circulating in the region. Phylogenetic analysis was performed with 24 strains of Brucella using concatenated sequences of genetic markers for species differentiation. The molecular clock hypothesis and Tajima's relative rate test were tested, showing that the Oliveri strain, similarly to other canis species, diverged from B. suis. The molecular clock hypothesis between Brucella species was rejected and an evolution rate and a similar genetic distance between the B. canis were demonstrated.

Keywords:
Insertions
Deletions
Indel events
Molecular clock
Texto completo
Introducción

Brucella canis, un patógeno intracelular facultativo, es responsable de la brucelosis canina, una enfermedad zoonótica que afecta a los caninos y que causa abortos y fallas reproductivas en las hembras, y orquitis y epididimitis en los machos2. En el humano se puede presentar la infección y producir cuadros clínicos leves, asintomáticos o graves22,24,47.

En Colombia se ha observado una seropositividad en caninos de entre el 1,49 y el 27,7, y fue del 9,1% en humanos9,17,33,36.

Hasta ahora, el análisis realizado a 30 cepas de B. canis aisladas de animales infectados demostró que las cepas circulantes son B. canis tipo 235. Se secuenció el genoma completo de una de las cepas aisladas de campo denominada Brucella canis str. Oliveri (HG803175.1-HG803176.1). En dicha cepa se reconocieron inserciones y deleciones específicas de especie, que se encuentran vinculadas con la síntesis de diferentes proteínas, algunas encargadas del transporte de nutrientes y aminoácidos, otras ribosomales y epimerasas, y algunas sin función conocida41. Tales cambios se pueden relacionar con la adaptación de la bacteria a su hospedero y al ambiente, con pérdida de material genético o producción de polimorfismos genéticos.

Para analizar la evolución del género Brucella se han desarrollado múltiples análisis filogenéticos. Existe consenso en separar en un clado las especies Brucella melitensis y Brucella abortus; otro clado está formado por las especies marinas, y se encuentra más relacionado con Brucella neotomae; otro clado lo conforman las especies Brucella suis y B. canis14,29. Se ha reconocido a Brucella ovis como la especie más ancestral de todas, y se ha planteado que el contagio inicial de cerdos, cabras y ganado vacuno se originó del contacto con ovejas infectadas, de 86.000 a 296.000 años atrás16.

B. canis siempre se ha encontrado formando parte del clado donde se halla B. suis, con altas similitudes, lo que en ocasiones llevó a diagnósticos errados (al considerar a esta como un miembro de la especie suis)19. Sobre la base de estos hallazgos se buscó conocer la filogenia y el ancestro evolutivo de la cepa de B. canis str. Oliveri en comparación con otras cepas de B. canis y con otras especies reconocidas dentro del género; además, se buscó determinar si esta es la única cepa que se encuentra circulando en toda la región, lo cual podría facilitar el desarrollo de estudios en epidemiología molecular de la bacteria.

Materiales y métodos

Para observar si las deleciones e inserciones reportadas en la cepa B. canis str. Oliveri estaban o no presentes en las 30 cepas de campo de B. canis reunidas, la metodología empleada fue la que se describe a continuación.

Cepas bacterianas

Las cepas fueron provistas por el grupo de investigación Biogénesis de la Universidad de Antioquia (Colombia) y confirmadas como B. canis por el Instituto Malbrán (Argentina); todas ellas fueron conservadas a −70°C.

La activación de las cepas se realizó en 5ml de caldo tripticasa soja, con incubación a 37°C durante 24h. Desde allí fueron repicadas en agar tripticasa soja e incubadas a 37°C durante 36-48h. Se realizó confirmación de la pureza de las cepas por medio de coloración de Gram. Adicionalmente se utilizaron como cepas control para la realización de los diferentes análisis las cepas vacunales de B. abortus S19 y RB51, ADN de B. melitensis 16M y ADN de B. suis 1330.

Extracción de ADN

La extracción del ADN se realizó a partir de 30 cepas de campo de B. canis identificadas previamente por hemocultivo, PCR punto final y 2-β-mercaptoetanol (2ME-RSAT)9. Como controles se utilizó ADN de B. abortus S19, B. abortus RB51, B. melitensis 16M y B. suis 1330. La extracción de ADN se realizó siguiendo el método conocido como boiling prep35. Brevemente, se tomaron 5 colonias de cada cepa, se resuspendieron en alícuotas de 0,5ml de PBS estéril, posteriormente fueron llevadas a ebullición por 10min y luego fueron centrifugadas a 12.000rpm durante 5min. El sobrenadante se usó para la realización de la PCR.

Selección de cebadores

Se diseñó un set de 5 pares de cebadores que permitieran determinar las inserciones y deleciones identificadas previamente en la cepa de B. canis str. Oliveri. En la tabla 1 se presentan los cebadores seleccionados y los productos de la PCR in silico.

Tabla 1.

Cebadores empleados para el análisis de las deleciones e inserciones observadas en la cepa Brucella canis str. Oliveri

Cebadores  Secuencia 5’-3’
 
Tamaño productos de PCR in silico   
    B. canis  Otras especies de Brucella 
BR0510  F: GTTCGGTAGTGCCGCTTTTC
R: TCTCGGCGATTCCGGAAGCC 
498pb  856pb 
BR0725  F: AGCAGTTCACCGAGCTTAAG
R: TCTATGCGAAGCCCGAGCTT 
491pb  788pb 
BR1846  F: GCAATTTTGCGCAGCTATTA
R: GTGAAAATAGGCAAGTTATT 
871pb  B. abortus: 556pb
B. ceti, B. melitensis, B. ovis: 429-493pb
B. microti: 1.060pb
B. suis: 682pb 
BR0485  F: CCCCAAAAAAGCCGCAACTA
R: CGCGCTCCCCCATAGCATTG 
286pb  B. suis, B. pinnipedialis, B. ceti: 226pb
B. abortus: 166pb
B. melitensis, B. ovis: no amplifica 
ARNt-Glu  F: ATAGACGGAAACACAGCAGGCT
R: TTGCAGACTTGCTTACAGACATGC 
296pb
 
B. abortus, B. melitensis, B. suis, B. canis: 514pb
B. ceti, B. ovis: 292pb 
Amplificación por PCR

La PCR se desarrolló según lo reportado por Ortiz et al.35. La amplificación se realizó en un termociclador PTC 200 (Perkin-Elmer Inc., San José, CA, EE. UU.). Como control negativo se utilizó agua destilada y como control positivo la cepa Oliveri de B. canis. Los productos de PCR fueron observados por electroforesis en gel de agarosa al 1% con 0,001μg/ml de bromuro de etidio, y visualizados con la ayuda de un transiluminador de luz UV (Transilluminator Mini Benchtop Model M-10E, UVP, Upland, CA, EE. UU.).

Secuenciación de los productos de PCR

La secuenciación de los productos de PCR se realizó por medio de un secuenciador automático 3730XL (www.macrogen.com). Los resultados obtenidos fueron revisados a partir de los cromatogramas y se compararon por medio de alineamientos en el programa Mega 6 con la secuencia de la cepa Oliveri.

Selección de secuencias para el análisis filogenético

Para conocer la filogenia y el ancestro evolutivo de la cepa B. canis str. Oliveri se utilizaron secuencias concatenadas de genes usados como marcadores de especies en Brucella spp. (tabla 2).

Tabla 2.

Genes usados como marcadores de especie

Genes housekeeping  Función  Bibliografía 
glK  Glucocinasa  Kim et al.18, Tiller et al. 43 y Valdezate et al.45
trpE  Antranilato sintasa 
cobQ  Ácido cobirínico sintasa 
aroA  3-fosfo-shikimato-1-carboxivinil transferasa 
dnaK  Chaperona 
gap  Gliceraldehído 3-fosfato deshidrogenasa 
gyrB  ADN girasa subunidad β 
rpoB  Subunidad β de ARN polimerasa 
Proteínas  Función  Bibliografía 
omp2a, omp2b, omp25, omp31  Proteínas de membrana implicadas en la virulencia de la bacteria  Ortega et al.34, Paulsen et al.37 y Wattiau et al.50 
Reconstrucción filogenética

Se realizaron alineamientos de las secuencias escogidas utilizando el algoritmo ClustalW para ADN. Para evaluar la calidad del alineamiento se tuvo en cuenta la distancia genética promedio medida con el programa Mega 6. El árbol filogenético se estableció usando los métodos de neighbor-joining, máxima parsimonia y máxima verosimilitud16. Usando ModelTest38 se seleccionó el mejor modelo de sustitución, utilizado para los análisis neighbor-joining y máxima verosimilitud. Las búsquedas heurísticas en máxima parsimonia y máxima verosimilitud se realizaron con el algoritmo subtree prunning and regrafting. En todos los análisis se realizó una medición del soporte de rama por medio de un bootstrap de 10.000 réplicas.

Reloj molecular y test de tasas relativas de Tajima

Por medio del programa Mega 6 se realizaron pruebas de hipótesis de reloj molecular con las secuencias concatenadas de los genes usados como marcadores de especies de Brucella.

Para probar la hipótesis del reloj molecular, primero se realizó un árbol con el modelo de sustitución más adecuado; asimismo, se comparó la cepa B. canis str. Oliveri con las diferentes especies de Brucella, empleando en ese análisis el likelihood ratio test con un nivel de confianza del 95%. Igualmente, se realizó el test de tasa relativa de Tajima entre B. canis str. Oliveri y B. canis ATCC 23365, utilizando como outgroup B. suis 1330. Se empleó la cepa B. canis ATCC 23365 porque al realizar la comparación de distancia genética entre dicha cepa y la cepa B. canis HSK A5214 (segunda cepa secuenciada de B. canis, aislada directamente de la sangre de un perro infectado en la República de Corea) aquella fue 0.

Resultados

Se encontró que las 30 cepas de campo analizadas compartían con la cepa B. canis str. Oliveri 4 de las 5 deleciones e inserciones que dicha cepa exhibe.

Deleciones

Entre las deleciones compartidas se determinó una de 358pb en el gen BR0510, relacionada con una epimerasa, lo cual derivó en un amplificado de 498pb, a diferencia de lo encontrado en las demás especies evaluadas, las cuales presentaron un amplificado de 856pb.

Se encontró una segunda deleción de 297pb en las 30 cepas de B. canis, relacionada con la enzima N-acetiltransferasa (BR0725); las demás especies de Brucella analizadas presentaron un tamaño de amplificado de 788pb, datos corroborados al realizar la secuenciación de los productos de PCR.

Hubo una última deleción de 218pb, reportada como la única exclusiva de la cepa Oliveri41. Esta deleción se relaciona con un ARN de transferencia de ácido glutámico (ARNt-Glu). Al observar los amplificados generados a partir de esta PCR demostró que no todas las cepas de campo analizadas compartían el mismo tamaño de amplificado con la cepa Oliveri (fig. 1): de las 30 cepas analizadas solo 5 presentaban el mismo tamaño de amplificado, mientras que las 25 restantes presentaron un tamaño de amplificado mayor, similar al reportado en las demás cepas de B. canis y en las otras especies de Brucella analizadas.

Figura 1.

Amplificación por PCR de ARNt-GLU, visualizado en gel de agarosa al 1%. A. Calle 1) Marcador de peso molecular 100 bp; calle 2) cepa 1; calle 3) cepa 2; calle 4) cepa 3; calle 5) cepa 4; calle 6) cepa 5; calle 7) cepa 6; calle 8) cepa 7; calle 9) cepa 8; calle 10) cepa 9; calle 11) cepa 10; calle 12) cepa 11; calle 13) control negativo. B. Calle 1) Marcador de peso molecular; calle 2) cepa 12; calle 3) cepa 13; calle 4) cepa 14; calle 5) cepa 14; calle 6) cepa 16; calle 7) cepa 17; calle 8) cepa 18; calle 9) cepa 19; calle 10) cepa vacunal S19; calle 11) control positivo; calle 13) control negativo; calle 14) B. canis str. Oliveri.

C. calle 1) Marcador de peso molecular; calle 3) cepa vacunal RB51. Calle 5) B. melitensis 16M; calle 6) B. suis 1330; calle 7) B. suis bv1; calle 9) control positivo; calle 10) control negativo.

(0,16MB).
Inserciones

Se evaluó primero la inserción (BR1846) de 189pb con respecto a B. suis, relacionada con un antirrepresor de profagos y compartida entre la cepa de B. canis str. Oliveri y todas las cepas de campo estudiadas, con un amplificado de 871pb, que difirió del de las especies B. abortus, B. melitensis y B. suis (556, 430 y 682pb, respectivamente).

Una segunda inserción presente en todas las cepas de B. canis (denominada BR0485) conforma una proteína hipotética; esta inserción genera una diferencia de 60pb al comparar con B. suis y con B. melitensis, especie que no presentó amplificado en el ensayo realizado in silico previamente. Sin embargo, cuando se comparó con las cepas vacunales de B. abortus, se observó una diferencia de 120pb a favor de B. canis.

Variabilidad interespecie

Con el propósito de diferenciar las especies a partir de las características halladas en la secuenciación de los productos amplificados (inserciones y deleciones), se realizaron árboles filogenéticos luego de efectuar el alineamiento de las cepas. De los árboles generados se presenta el árbol dado a partir del alineamiento del gen BR1846, un árbol sin raíz generado por el método de neighbor joining con el modelo de sustitución de Jukes y Cantor y 1.000 réplicas de bootstrap, que muestra diferenciación en clados de cada una de las especies analizadas, pero a la vez demuestra la cercanía entre B. canis y B. suis48,52, y la alta similitud entre las cepas de campo de B. canis y la cepa Oliveri previamente secuenciada (fig. 2).

Figura 2.

Árbol generado a partir del gen BR1846, incluyendo 34 secuencias de 4 especies. El árbol se construyó utilizando el método de distancia de neighbor-joining, con el modelo de sustitución de Jukes y Cantor y un soporte de rama de 10.000 réplicas.

(0,2MB).
Análisis filogenético a partir de genes housekeeping

Cuando se realizó la comparación entre los genes housekeeping reportados para Brucella spp., se observó que de las 24 cepas de Brucella, incluyendo la Oliveri, con Ochrobactrum anthropi como grupo externo, 1.053 sitios informativos fueron encontrados por parsimonia; de estos, 467 eran informativos solo entre las diferentes especies de Brucella.

De los métodos de análisis, el que presentó una mejor topología y soporte de rama fue el corrido con neighbor-joining con Tamura-Nei 93 (TN93) y un bootstrap de 10.000 (fig. 3).

Figura 3.

Árbol enraizado del género Brucella, incluyendo 23 secuencias de 9 especies. El árbol se construyó utilizando el método de distancia de neighbor-joining, con el modelo de sustitución de Tamura-Nei y un soporte de rama de 10.000 réplicas, utilizando la especie Ochrobactrum anthropi como outgroup.

(0,17MB).
Reloj molecular y tasas relativas de Tajima

La distancia genética entre las cepas de B. canis ATCC 23365 y la cepa HSK A52141 fue igual a 0; las cepas ATCC 23365 y Oliveri también presentaron una divergencia simultánea (p>0,05).

Discusión

En el presente estudio se encontró que las cepas de campo de B. canis estudiadas, todas ellas aisladas de muestras clínicas obtenidas en la región de Antioquia (Colombia), comparten con B. canis str. Oliveri 4 de los 5 indels analizados, lo que se relaciona con algunas ventajas para la bacteria desde el punto de vista de la transferencia horizontal de genes49 (resistencia en el ambiente y pobre respuesta inmune15,40) y con algunas desventajas, entre ellas, una mayor sensibilidad a medicamentos (como los aminoglucósidos24,27), e implicaciones desde el punto de vista de la patogenicidad y la sobrevivencia intracelular6,15,20.

Dentro de las inserciones compartidas se observó una vinculada con un antirrepresor de profagos relacionado con la transferencia horizontal de genes, algunos de los cuales codifican el sistema de secreción tipo IV y los lipopolisacáridos. Particularmente, en este estudio se observó una variabilidad interespecie (fig. 2), lo que evidenciaría su empleo como marcador de especie. Asimismo, la presencia de esta inserción podría facilitar la interacción de B. canis con otras especies bacterianas y favorecer así el desarrollo intracelular y la transferencia de genes, algunos posiblemente relacionados con la virulencia49.

Otra inserción compartida entre las cepas de campo estudiadas y B. canis str. Oliveri corresponde a una proteína hipotética, dado que en la actualidad no tiene una función definida. Sin embargo, empleando el servidor Phyre 2 se realizó una predicción de la estructura y la función de esta proteína y se encontró a nivel estructural un 59% de hélices alfa y un 6% de láminas beta. Algunos estudios refieren que este tipo de proteínas podrían participar como proteínas de unión a ADN1; de igual manera, cuando se realizó la predicción en cuanto a su función, se encontraron diferentes dominios relacionados con proteínas de unión a ADN en otros organismos. Sería importante analizar el papel que cumple esta proteína dentro de la sobrevida de la bacteria en el hospedero.

En relación con las deleciones, se observó que 2 de ellas (BR0510 y BR0725) son compartidas entre todas las cepas de campo analizadas.

Una de las deleciones corresponde a una epimerasa a la cual se le han atribuido características funcionales en la biosíntesis de hidratos de carbono de superficie, del antígeno O y del core del lipopolisacárido7, relacionándose con las características fenotípicas de las colonias rugosas observadas en todas las cepas de campo analizadas32,53. Además, se ha reportado que puede generar variaciones desde el punto de vista de la antigenicidad, debido a que el antígeno O es un factor importante en la patogenicidad de Brucella en el humano, siendo una posible explicación de su menor virulencia comparada con las especies de B. suis, B. abortus y B. melitensis15,40; de ahí que a nivel mundial se cuente con una menor cantidad de reportes de brucelosis canina en humanos6,10,21,24,33.

Asimismo, otra segunda deleción encontrada en las cepas de campo estudiadas y compartida con B. canis str. Oliveri se ubicó en el gen que codifica una N-acetiltransferasa, la cual forma parte de una superfamilia de proteínas encargadas de impedir la acción de los aminoglucósidos26,28,39,44, antibióticos empleados en el tratamiento de la brucelosis tanto en humanos como en animales11,12,26. Los resultados observados en este estudio podrían indicar que esta deleción haría a las cepas de B. canis más sensibles al tratamiento con estos antibióticos3,25,30. Además, esta superfamilia se encuentra relacionada con la regulación de la transcripción, la traducción de señales8, el metabolismo, la respuesta al estrés y la degradación proteica46, lo que las torna de gran importancia y valor biológico; de ahí que esta deleción, además de indicar una posible sensibilidad antibiótica, podría generar otro tipo de reacciones desfavorables en la bacteria, como una menor tolerancia al estrés, o posibles alteraciones en su actividad enzimática23.

La última deleción analizada, de 218pb, fue descrita en estudios previos como exclusiva de la cepa Oliveri41 y se relaciona con un ARNt-Glu41, específico para transportar este ácido hacia el ribosoma en preparación para la síntesis de proteínas. Actúa en primer lugar como activador enzimático y luego como sustrato en el proceso de aminoacilación42. Se ha reportado que algunos ARNt tienen un rol importante en algunas rutas metabólicas, como es el caso del ARNt-Glu, empleado por plantas, arqueas y bacterias para la síntesis de tetrapirroles, como la clorofila, la vitamina B12 y las hemoproteínas presentes en organismos fotosintéticos e involucradas tanto en la fotosíntesis como en la respiración.

Algunos investigadores han reportado este tipo de proteínas en algunas bacterias quimiotrópicas, como es el caso de B. abortus y B. melitensis31. Se ha descrito que en bacterias no fotosintéticas, la absorción de la energía lumínica mediante moléculas fotosensibilizadoras, como tetrapirroles, puede generar efectos deletéreos en ácidos nucleicos y proteínas a través de la liberación de especies reactivas del oxígeno, que son tóxicas para la célula y llevan a su muerte13. En B. abortus se han descrito proteínas sensoras de luz (fotorreceptores) que les permiten desarrollar una respuesta adaptativa a este factor de estrés, haciendo que absorban la luz a través de cromóforos y, de esta forma, resisten tanto el daño fotooxidativo como el del ADN por la presencia de tetrapirroles13,20,51.

De las 30 cepas de campo estudiadas, solo 5 presentaron esta deleción, lo que evidencia una relación con B. canis str. Oliveri (fig. 1). Es posible que las que poseen el ARNt-Glu presenten una mayor sobrevida no solo en el medio ambiente, sino en el interior de macrófagos, como se ha reportado en otras especies, entre ellas, B. abortus13,20,51. Se requiere el desarrollo de estudios complementarios sobre la expresión de los genes LOV en las cepas de campo de B. canis ARNt glu estudiadas y comparar si la presencia de ARNt-Glu y de dominios LOV estimula no solo la sobrevida en el medio ambiente, sino también la virulencia de la bacteria en términos de sobrevida intracelular.

Los análisis filogenéticos realizados (fig. 3), incluyendo O. anthropi como grupo externo, arrojaron algunos resultados acordes con las filogenias reportadas por otros autores, las que sitúan a B. ovis como el primer linaje en dividirse del resto de las especies de Brucella y la reconocen como la especie basal14,16.

En consonancia con lo ya reportado, B. suis es la especie que presenta una mayor diversidad genética en las cepas estudiadas16; la cepa 1330 es la primera en divergir, seguida por B. suis ATCC 23445, que presenta la rama más distante, mientras que B. suis bv. 3 se halla más cercana a las cepas de B. canis, formando parte de este mismo clado, con una menor divergencia16.

B. abortus y B. melitensis se ubican como especies hermanas, cada una de ellas monofilética. Brucella microti aparece más cercana al clado de B. abortus, en contraposición con lo reportado por Audic et al.5, quienes demuestran una mayor cercanía de esta especie a O. anthropi4. Dentro del clado formado por B. abortus se observa una diversidad genética mínima entre las cepas, mientras que las cepas de B. melitensis presentan una divergencia mayor; se corrobora de este modo lo ya reportado por Foster et al.16. Las cepas acuáticas Brucella pinnipedialis y Brucella ceti se encuentran formando parte del mismo clado y separadas de las cepas terrestres, de manera similar a lo reportado por Audic et al.4, quienes emplearon genes ortólogos.

Dentro de las cepas de B. canis se presentó una distancia genética entre las cepas ATCC 23365 y la cepa HSK A52141 igual a 0; además, a partir del test de tasas relativas de Tajima, las cepas ATCC 23365 y Oliveri aparecen con una divergencia simultánea (p>0,05), lo que indica que las 2 secuencias evolucionaron al mismo ritmo desde que se separaron de su ancestro común más reciente27. A partir de estos resultados, y luego del rechazo de la prueba de hipótesis de reloj molecular, se puede afirmar que la tasa de evolución entre todas las ramas del árbol generado a partir de las especies de Brucella no es la misma, y solo se pueden corroborar relojes locales entre algunas especies, como B. suis y B. canis.

A partir de los resultados obtenidos se puede concluir que en la región de Antioquia (Colombia) se encuentran circulando otras cepas de B. canis, aparte de la mencionada B. canis str. Oliveri. En adición a esto, la variabilidad interespecie presentada a partir de la inserción BR1846 podría servir como marcador entre las especies de este género bacteriano. Asimismo, este estudio permite confirmar que todas las cepas de B. canis divergieron a partir de B. suis.

Responsabilidades éticasProtección de personas y animales

Los autores declaran que para esta investigación no se han realizado experimentos en seres humanos ni en animales.

Confidencialidad de los datos

Los autores declaran que en este artículo no aparecen datos de pacientes.

Derecho a la privacidad y consentimiento informado

Los autores declaran que en este artículo no aparecen datos de pacientes.

Financiación

El presente trabajo fue financiado por el proyecto CODI 2014-750.

Conflicto de intereses

Los autores declaran que no existe ningún conflicto de intereses que ponga en peligro la validez de los resultados presentados.

Agradecimientos

Los autores quieren manifestar sus agradecimientos a la Universidad de Antioquia.

Bibliografía
[1]
K.Y. Acosta-Viana, J.E. Zavala-Castro.
Proteínas de unión a DNA.
Rev Biomed., 7 (1996), pp. 163-172
[2]
S. Ardoino, D. Baruta, R. Toso.
Brucelosis canina.
Cien Vet., 8 (2006), pp. 50-61
[3]
J. Ariza, M. Bosilkovski, A. Cascio, J.D. Colmenero, M.J. Corbel, M.E. Falagas, Z.A. Memish, M.R. Roushan, E. Rubinstein, N.V. Sipsas.
Perspectives for the treatment of brucellosis in the 21st century: The Ioannina recommendations.
[4]
S. Audic, M. Lescot, J.M. Claverie, A. Cloeckaert, M.S. Zygmunt.
The genome sequence of Brucella pinnipedialis B2/94 sheds light on the evolutionary history of the genus Brucella.
BMC Evol Biol., 11 (2011), pp. 200
[5]
S. Audic, M. Lescot, J.-M. Claverie, H.C. Scholz.
Brucella microti: The genome sequence of an emerging pathogen.
BMC Genomics., 10 (2009), pp. 352
[6]
I. Breve.
Endocarditis por Brucella canis: primer caso documentado en un paciente adulto en Argentina.
Rev Argent Microbiol., 45 (2013), pp. 50-53
[7]
R. Canals, N. Jiménez, S. Vilches, M. Regué, S. Merino, J.M. Tomás.
Role of Gne and GalE in the virulence of Aeromonas hydrophila serotype O34.
J Bacteriol., 189 (2007), pp. 540-550
[8]
W. Cao, C. Bao, E. Padalko, C.J. Lowenstein.
Acetylation of mitogen-activated protein kinase phosphatase-1 inhibits Toll-like receptor signaling.
J Exp Med., 205 (2008), pp. 1491-1503
[9]
L. Castrillón-Salazar, C.A. Giraldo-Echeverri, M.M. Sánchez-Jiménez, M. Olivera-Angel.
Factors associated with Brucella canis seropositivity in kennels of two regions of Antioquia, Colombia.
Cad Saude Publica., 29 (2013), pp. 1955-1973
[10]
C.M. Dentinger, K. Jacob, L.V. Lee, H.A. Mendez, K. Chotikanatis, P.L. McDonough, D.M. Chico, B.K. De, R. Tiller, R. Traxler, E.R. Campagnolo, D. Schmitt, M.A. Guerra, S.A. Slavinski.
Human Brucella canis infection and subsequent laboratory exposures associated with a puppy, New York City, 2012.
Zoonoses Public Health., 62 (2015), pp. 407-414
[11]
A. Deshmukh, F. Hagen, O. Al Sharabasi, M. Abraham, G. Wilson, S. Doiphode, M. Al Maslamani, J.F. Meis.
In vitro antimicrobial susceptibility testing of human Brucella melitensis isolates from Qatar between 2014-2015.
BMC Microbiol., 15 (2015), pp. 121
[12]
L. Dieste-Pérez, L. Fraile, M. de Miguel, M. Barberán, J. Blasco, P. Muñoz.
Studies on a suitable antibiotic therapy for treating swine brucellosis.
J Vet Pharmacol Ther., 38 (2015), pp. 357-364
[13]
M. Elías-Arnanz, S. Padmanabhan, F.J. Murillo.
Light-dependent gene regulation in nonphototrophic bacteria.
Curr Opin Microbiol., 14 (2011), pp. 128-135
[14]
T. Ficht.
Brucella taxonomy and evolution.
Future Microbiol, 5 (2010), pp. 859-866
[15]
J.T. Foster, S.M. Beckstrom-Sternberg, T. Pearson, J.S. Beckstrom-Sternberg, P.S. Chain, F.F. Roberto, J. Hnath, T. Brettin, P. Keim.
Whole-genome-based phylogeny and divergence of the genus Brucella.
J Bacteriol., 191 (2009), pp. 2864-2870
[16]
C.A. Giraldo Echeverri, Z.T. Ruiz Cortés, M. Olivera Ángel.
Brucella canis en Medellín (Colombia), un problema actual.
Rev UDCA Actual Divulg Cient., 12 (2009),
[17]
M.P. Jiménez de Bagüés, A. Terraza, A. Gross, J. Dornand.
Different responses of macrophages to smooth and rough Brucella spp.: Relationship to virulence.
Infect Immun., 72 (2004), pp. 2429-2433
[18]
S.G. Kim, Y.H. Kim, M.J. Chae, J.W. Kim, Y.J. Lee.
Real-time PCR assay based glyceraldehydes 3-phosphate gene for identification of Brucella sp.
J Anim Vet Adv., 9 (2010), pp. 2315-2320
[19]
I. López-Goñi, D. García-Yoldi, C.M. Marín, M.J. de Miguel, E. Barquero-Calvo, C. Guzmán-Verri, D. Albert, B. Garin-Bastuji.
New Bruce-ladder multiplex PCR assay for the biovar typing of Brucella suis and the discrimination of Brucella suis and Brucella canis.
Vet Microbiol., 154 (2011), pp. 152-155
[20]
A. Losi, W. Gärtner.
Bacterial bilin- and flavin-binding photoreceptors.
Photochem Photobiol Sci., 7 (2008), pp. 1168-1178
[21]
N. Lucero, R. Corazza, M. Almuzara, E. Reynes, G. Escobar, E. Boeri, S. Ayala.
Human Brucella canis outbreak linked to infection in dogs.
Epidemiol Infect., 138 (2010), pp. 280-285
[22]
N.E. Lucero, G.I. Escobar, S.M. Ayala, N. Jacob.
Diagnosis of human brucellosis caused by Brucella canis.
J Med Microbiol., 54 (2005), pp. 457-461
[23]
Q. Ma, T.K. Wood.
Protein acetylation in prokaryotes increases stress resistance.
Biochem Biophys Res Commun., 410 (2011), pp. 846-851
[24]
S. Marzetti, C. Carranza, M. Roncallo, G.I. Escobar, N.E. Lucero.
Recent trends in human Brucella canis infection.
Comp Immunol Microbiol Infect Dis., 36 (2013), pp. 55-61
[25]
E. Mateu-de-Antonio, M. Martin.
In vitro efficacy of several antimicrobial combinations against Brucella canis and Brucella melitensis strains isolated from dogs.
Vet Microbiol., 45 (1995), pp. 1-10
[26]
M. Maurin, D. Raoult.
Use of aminoglycosides in treatment of infections due to intracellular bacteria.
Antimicrob Agents Chemother., 45 (2001), pp. 2977-2986
[27]
U. Milstein.
Estudio de la velocidad de evolución molecular en tripanosomátidos [tesis de grado].
Universidad de la República, (2013),
[28]
E. Miró, F. Grünbaum, L. Gómez, A. Rivera, B. Mirelis, P. Coll, F. Navarro.
Characterization of aminoglycoside-modifying enzymes in enterobacteriaceae clinical strains and characterization of the plasmids implicated in their diffusion.
Microb Drug Resist., 19 (2013), pp. 94-99
[29]
E. Moreno, A. Cloeckaert, I. Moriyón.
Brucella evolution and taxonomy.
Vet Microbiol., 90 (2002), pp. 209-227
[30]
S. Morley, C. Eccleston, A. Williams.
Systematic review and meta-analysis of randomized controlled trials of cognitive behaviour therapy and behaviour therapy for chronic pain in adults, excluding headache.
Pain., 80 (1999), pp. 1-13
[31]
J. Moser, W.D. Schubert, V. Beier, I. Bringemeier, D. Jahn, D.W. Heinz.
V-shaped structure of glutamyl-tRNA reductase, the first enzyme of tRNA-dependent tetrapyrrole biosynthesis.
EMBO J., 20 (2001), pp. 6583-6590
[32]
K. Nielsen, W. Yu.
Serological diagnosis of brucellosis.
Prilozi., 31 (2010), pp. 65-89
[33]
M. Olivera, C. Di-Lorenzo.
Aislamiento de Brucella canis en un humano conviviente con caninos infectados. Informe de un caso.
Colomb Med., 40 (2009), pp. 218-220
[34]
Ortega M, Valdezate S, Sáez-Nieto JA. Diversidad genética de Brucella en España. SEM@foro. 2013;55:38-44 [On-line; consultado 7 Sep 2015]. Disponible en: https://www.semicrobiologia.org/pdf/actualidad/55/14_Brucella_55.pdfhttps://www.semicrobiologia.org/pdf/actualidad/55/14_Brucella_55.pdf
[35]
L.F. Ortiz, C. Muskus, M.M. Sánchez, M. Olivera.
Identification of Brucella canis Group 2 in Colombian kennels.
Rev Colom Cienc Pecua., 25 (2012), pp. 615-619
[36]
A. Pardo, C. Pérez, A. Góngora, L. Gómez, A. Moreno.
Encuesta exploratoria de infección por Brucella canis en perros de Villavicencio-Colombia.
Revista MVZ Cordoba., 14 (2009), pp. 1690-1696
[37]
I.T. Paulsen, R. Seshadri, K.E. Nelson, J.A. Eisen, J.F. Heidelberg, T.D. Read, R.J. Dodson, L. Umayam, L.M. Brinkac, M.J. Beanan.
The Brucella suis genome reveals fundamental similarities between animal and plant pathogens and symbionts.
Proc Natl Acad Sci U S A., 99 (2002), pp. 13148-13153
[38]
D. Posada, K.A. Crandall.
Modeltest: Testing the model of DNA substitution.
Bioinformatics., 14 (1998), pp. 817-818
[39]
P. Rather, H. Munayyer, P. Mann, R. Hare, G. Miller, K. Shaw.
Genetic analysis of bacterial acetyltransferases: Identification of amino acids determining the specificities of the aminoglycoside 6’-N-acetyltransferase Ib and IIa proteins.
J Bacteriol., 174 (1992), pp. 3196-3203
[40]
M.G. Rittig, A. Kaufmann, A. Robins, B. Shaw, H. Sprenger, D. Gemsa, V. Foulongne, B. Rouot, J. Dornand.
Smooth and rough lipopolysaccharide phenotypes of Brucella induce different intracellular trafficking and cytokine/chemokine release in human monocytes.
J Leukoc Biol., 74 (2003), pp. 1045-1055
[41]
M.M. Sánchez-Jiménez, J.P. Isaza, J.F. Alzate, M. Olivera-Angel.
Comparison of Brucella canis genomes isolated from different countries shows multiple variable regions.
Genomics., 106 (2015), pp. 43-51
[42]
S. Sekine, M. Shichiri, S. Bernier, R. Chênevert, J. Lapointe, S. Yokoyama.
Structural bases of transfer RNA-dependent amino acid recognition and activation by glutamyl-tRNA synthetase.
Structure., 14 (2006), pp. 1791-1799
[43]
R.V. Tiller, J.E. Gee, M.A. Frace, T.K. Taylor, J.C. Setubal, A.R. Hoffmaster, B.K. De.
Characterization of novel Brucella strains originating from wild native rodent species in North Queensland, Australia.
Appl Environ Microbiol., 76 (2010), pp. 5837-5845
[44]
S.B. Vakulenko, S. Mobashery.
Versatility of aminoglycosides and prospects for their future.
Clin Microbiol Rev., 16 (2003), pp. 430-450
[45]
S. Valdezate, A. Navarro, P. Villalón, G. Carrasco, J.A. Saéz-Nieto.
Epidemiological and phylogenetic analysis of Spanish human Brucella melitensis strains by multiple-locus variable-number tandem-repeat typing, hypervariable octameric oligonucleotide fingerprinting, and rpoB typing.
J Clin Microbiol., 48 (2010), pp. 2734-2740
[46]
V. Van Noort, J. Seebacher, S. Bader, S. Mohammed, I. Vonkova, M.J. Betts, S. Kühner, R. Kumar, T. Maier, M. O’Flaherty.
Cross-talk between phosphorylation and lysine acetylation in a genome-reduced bacterium.
Mol Syst Biol., 8 (2012), pp. 571
[47]
J.C. Wallach, G.H. Giambartolomei, P.C. Baldi, C.A. Fossati.
Human infection with M-strain of Brucella canis.
Emerg Infect Dis., 10 (2004), pp. 146-148
[48]
A.R. Wattam, J.T. Foster, S.P. Mane, S.M. Beckstrom-Sternberg, J.M. Beckstrom-Sternberg, A.W. Dickerman, P. Keim, T. Pearson, M. Shukla, D.V. Ward.
Comparative phylogenomics and evolution of the Brucellae reveal a path to virulence.
J Bacteriol., 196 (2014), pp. 920-930
[49]
A.R. Wattam, K.P. Williams, E.E. Snyder, N.F. Almeida, M. Shukla, A. Dickerman, O. Crasta, R. Kenyon, J. Lu, J. Shallom.
Analysis of ten Brucella genomes reveals evidence for horizontal gene transfer despite a preferred intracellular lifestyle.
J Bacteriol., 191 (2009), pp. 3569-3579
[50]
P. Wattiau, A.M. Whatmore, M. van Hessche, J. Godfroid, D. Fretin.
Nucleotide polymorphism-based single-tube test for robust molecular identification of all currently described Brucella species.
Appl Environ Microbiol., 77 (2011), pp. 6674-6679
[51]
A.H. West, A.M. Stock.
Histidine kinases and response regulator proteins in two-component signaling systems.
Trends Biochem Sci., 26 (2001), pp. 369-376
[52]
Z. Zhong, Y. Wang, J. Xu, Y. Chen, Y. Ke, X. Zhou, X. Yuan, D. Zhou, Y. Yang, R. Yang.
Parallel gene loss and acquisition among strains of different Brucella species and biovars.
J Microbiol., 50 (2012), pp. 567-574
[53]
M.S. Zygmunt, J.M. Blasco, J.J. Letesson, A. Cloeckaert, I. Moriyón.
DNA polymorphism analysis of Brucella lipopolysaccharide genes reveals marked differences in O-polysaccharide biosynthetic genes between smooth and rough Brucella species and novel species-specific markers.
BMC Microbiol., 9 (2009), pp. 92
Copyright © 2017. Asociación Argentina de Microbiología
Opciones de artículo
Herramientas
es en pt

¿Es usted profesional sanitario apto para prescribir o dispensar medicamentos?

Are you a health professional able to prescribe or dispense drugs?

Você é um profissional de saúde habilitado a prescrever ou dispensar medicamentos

es en pt
Política de cookies Cookies policy Política de cookies
Utilizamos cookies propias y de terceros para mejorar nuestros servicios y mostrarle publicidad relacionada con sus preferencias mediante el análisis de sus hábitos de navegación. Si continua navegando, consideramos que acepta su uso. Puede cambiar la configuración u obtener más información aquí. To improve our services and products, we use "cookies" (own or third parties authorized) to show advertising related to client preferences through the analyses of navigation customer behavior. Continuing navigation will be considered as acceptance of this use. You can change the settings or obtain more information by clicking here. Utilizamos cookies próprios e de terceiros para melhorar nossos serviços e mostrar publicidade relacionada às suas preferências, analisando seus hábitos de navegação. Se continuar a navegar, consideramos que aceita o seu uso. Você pode alterar a configuração ou obter mais informações aqui.