covid
Buscar en
Brazilian Journal of Microbiology
Toda la web
Inicio Brazilian Journal of Microbiology Campylobacter in broiler slaughter samples assessed by direct count on mCCDA and...
Journal Information

Statistics

Follow this link to access the full text of the article

Veterinary Microbiology
Campylobacter in broiler slaughter samples assessed by direct count on mCCDA and Campy-Cefex agar
Camila Cristina Gonsalvesa,
Corresponding author
anderliseb@yahoo.com.br

Corresponding author.
, Anderlise Borsoib, Gustavo Perdoncinia, Laura Beatriz Rodriguesc, Vladimir Pinheiro do Nascimentoa
a Centro de Diagnóstico e Pesquisa em Patologia Aviária (CDPA) – FAVET/UFRGS – Lab. Central – Porto Alegre, RS, Brazil
b Departamento de Patologia Experimental e Comparada – Faculdade de Medicina Veterinária e Zootecnia (USP), Brazil
c Curso de Medicina Veterinária da Faculdade de Agronomia e Medicina Veterinária da Universidade de Passo Fundo (UPF), Brazil
Read
2359
Times
was read the article
859
Total PDF
1500
Total HTML
Share statistics
 array:24 [
  "pii" => "S151783821630288X"
  "issn" => "15178382"
  "doi" => "10.1016/j.bjm.2016.04.025"
  "estado" => "S300"
  "fechaPublicacion" => "2016-07-01"
  "aid" => "102"
  "copyright" => "Sociedade Brasileira de Microbiologia"
  "copyrightAnyo" => "2016"
  "documento" => "article"
  "crossmark" => 1
  "licencia" => "http://creativecommons.org/licenses/by-nc-nd/4.0/"
  "subdocumento" => "fla"
  "cita" => "Braz J Microbiol. 2016;47:764-9"
  "abierto" => array:3 [
    "ES" => true
    "ES2" => true
    "LATM" => true
  ]
  "gratuito" => true
  "lecturas" => array:2 [
    "total" => 1129
    "formatos" => array:3 [
      "EPUB" => 153
      "HTML" => 590
      "PDF" => 386
    ]
  ]
  "itemSiguiente" => array:19 [
    "pii" => "S1517838216302805"
    "issn" => "15178382"
    "doi" => "10.1016/j.bjm.2016.04.017"
    "estado" => "S300"
    "fechaPublicacion" => "2016-07-01"
    "aid" => "94"
    "copyright" => "Sociedade Brasileira de Microbiologia"
    "documento" => "article"
    "crossmark" => 1
    "licencia" => "http://creativecommons.org/licenses/by-nc-nd/4.0/"
    "subdocumento" => "fla"
    "cita" => "Braz J Microbiol. 2016;47:770-4"
    "abierto" => array:3 [
      "ES" => true
      "ES2" => true
      "LATM" => true
    ]
    "gratuito" => true
    "lecturas" => array:2 [
      "total" => 1131
      "formatos" => array:3 [
        "EPUB" => 175
        "HTML" => 616
        "PDF" => 340
      ]
    ]
    "en" => array:12 [
      "idiomaDefecto" => true
      "cabecera" => "<span class="elsevierStyleTextfn">Veterinary Microbiology</span>"
      "titulo" => "Is <span class="elsevierStyleItalic">Malassezia nana</span> the main species in horses&#8217; ear canal microbiome&#63;"
      "tienePdf" => "en"
      "tieneTextoCompleto" => "en"
      "tieneResumen" => "en"
      "paginas" => array:1 [
        0 => array:2 [
          "paginaInicial" => "770"
          "paginaFinal" => "774"
        ]
      ]
      "contieneResumen" => array:1 [
        "en" => true
      ]
      "contieneTextoCompleto" => array:1 [
        "en" => true
      ]
      "contienePdf" => array:1 [
        "en" => true
      ]
      "resumenGrafico" => array:2 [
        "original" => 0
        "multimedia" => array:7 [
          "identificador" => "fig0005"
          "etiqueta" => "Fig&#46; 1"
          "tipo" => "MULTIMEDIAFIGURA"
          "mostrarFloat" => true
          "mostrarDisplay" => false
          "figura" => array:1 [
            0 => array:4 [
              "imagen" => "gr1.jpeg"
              "Alto" => 822
              "Ancho" => 950
              "Tamanyo" => 90945
            ]
          ]
          "descripcion" => array:1 [
            "en" => "<p id="spar0010" class="elsevierStyleSimplePara elsevierViewall">PCR&#46; 1 and 16&#58; ladder &#40;100<span class="elsevierStyleHsp" style=""></span>pb&#41;&#59; 2&#46; positive control &#8211; <span class="elsevierStyleItalic">M&#46; pachydermatis</span> &#40;CBS 1696&#41; &#40;580<span class="elsevierStyleHsp" style=""></span>bp&#41;&#59; 3&#46; negative control &#8211; Milli-Q&#59; 4&#44; 5&#44; 6&#44; 7&#44; 8&#44; 9&#44; 10&#44; 11&#44; 13&#44; 14 and 15&#58; isolates from horses&#8217; ear canals &#8211; positive for <span class="elsevierStyleItalic">Malassezia</span> sp&#59; 12&#46; Blank&#46;</p>"
          ]
        ]
      ]
      "autores" => array:1 [
        0 => array:2 [
          "autoresLista" => "Ana L&#250;cia Aldrovandi, Lika Osugui, Selene Dall&#8217; Acqua Coutinho"
          "autores" => array:3 [
            0 => array:2 [
              "nombre" => "Ana L&#250;cia"
              "apellidos" => "Aldrovandi"
            ]
            1 => array:2 [
              "nombre" => "Lika"
              "apellidos" => "Osugui"
            ]
            2 => array:2 [
              "nombre" => "Selene Dall&#8217;"
              "apellidos" => "Acqua Coutinho"
            ]
          ]
        ]
      ]
    ]
    "idiomaDefecto" => "en"
    "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S1517838216302805?idApp=UINPBA00004N"
    "url" => "/15178382/0000004700000003/v2_201704050113/S1517838216302805/v2_201704050113/en/main.assets"
  ]
  "itemAnterior" => array:19 [
    "pii" => "S1517838216303070"
    "issn" => "15178382"
    "doi" => "10.1016/j.bjm.2016.04.027"
    "estado" => "S300"
    "fechaPublicacion" => "2016-07-01"
    "aid" => "104"
    "copyright" => "Sociedade Brasileira de Microbiologia"
    "documento" => "article"
    "crossmark" => 1
    "licencia" => "http://creativecommons.org/licenses/by-nc-nd/4.0/"
    "subdocumento" => "fla"
    "cita" => "Braz J Microbiol. 2016;47:757-63"
    "abierto" => array:3 [
      "ES" => true
      "ES2" => true
      "LATM" => true
    ]
    "gratuito" => true
    "lecturas" => array:2 [
      "total" => 1187
      "formatos" => array:3 [
        "EPUB" => 156
        "HTML" => 648
        "PDF" => 383
      ]
    ]
    "en" => array:12 [
      "idiomaDefecto" => true
      "cabecera" => "<span class="elsevierStyleTextfn">Food Microbiology</span>"
      "titulo" => "Inactivation of <span class="elsevierStyleItalic">Listeria monocytogenes</span> ATCC 7644 on fresh-cut tomato using nisin in combinations with organic salts"
      "tienePdf" => "en"
      "tieneTextoCompleto" => "en"
      "tieneResumen" => "en"
      "paginas" => array:1 [
        0 => array:2 [
          "paginaInicial" => "757"
          "paginaFinal" => "763"
        ]
      ]
      "contieneResumen" => array:1 [
        "en" => true
      ]
      "contieneTextoCompleto" => array:1 [
        "en" => true
      ]
      "contienePdf" => array:1 [
        "en" => true
      ]
      "resumenGrafico" => array:2 [
        "original" => 0
        "multimedia" => array:7 [
          "identificador" => "fig0005"
          "etiqueta" => "Fig&#46; 1"
          "tipo" => "MULTIMEDIAFIGURA"
          "mostrarFloat" => true
          "mostrarDisplay" => false
          "figura" => array:1 [
            0 => array:4 [
              "imagen" => "gr1.jpeg"
              "Alto" => 1387
              "Ancho" => 1441
              "Tamanyo" => 105150
            ]
          ]
          "descripcion" => array:1 [
            "en" => "<p id="spar0010" class="elsevierStyleSimplePara elsevierViewall"><span class="elsevierStyleItalic">Listeria monocytogenes</span> populations &#40;log<span class="elsevierStyleHsp" style=""></span>CFU&#47;mL&#41; on fresh-cut tomato &#40;<span class="elsevierStyleItalic">n</span><span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>3&#41; stored at 4<span class="elsevierStyleHsp" style=""></span>&#176;C with nisin alone and in combinations with the organic salts as well as in the chlorine control &#40;Lm&#8722;&#44; <span class="elsevierStyleItalic">L&#46; monocytogenes</span>&#59; Lm&#43;Nisin&#44; <span class="elsevierStyleItalic">L&#46; monocytogenes</span> and nisin&#59; Lm&#43;Ns&#43;SC3&#37;&#44; <span class="elsevierStyleItalic">L&#46; monocytogenes</span>&#44; nisin and 3&#37; sodium citrate&#59; Lm&#43;Ns&#43;SC5&#37;&#44; <span class="elsevierStyleItalic">L&#46; monocytogenes</span>&#44; nisin and 5&#37; sodium citrate&#59; Lm&#43;Ns&#43;SA3&#37;&#44; <span class="elsevierStyleItalic">L&#46; monocytogenes</span>&#44; nisin and 3&#37; sodium acetate&#59; Lm&#43;Ns&#43;SC5&#37;&#44; <span class="elsevierStyleItalic">L&#46; monocytogenes</span>&#44; nisin and 5&#37; sodium acetate&#59; at Lm&#43;CL&#8722; <span class="elsevierStyleItalic">L&#46; monocytogenes</span> and chlorine&#41;&#46;</p>"
          ]
        ]
      ]
      "autores" => array:1 [
        0 => array:2 [
          "autoresLista" => "Adebola O&#46; Oladunjoye, Suren Singh, Oluwatosin A&#46; Ijabadeniyi"
          "autores" => array:3 [
            0 => array:2 [
              "nombre" => "Adebola O&#46;"
              "apellidos" => "Oladunjoye"
            ]
            1 => array:2 [
              "nombre" => "Suren"
              "apellidos" => "Singh"
            ]
            2 => array:2 [
              "nombre" => "Oluwatosin A&#46;"
              "apellidos" => "Ijabadeniyi"
            ]
          ]
        ]
      ]
    ]
    "idiomaDefecto" => "en"
    "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S1517838216303070?idApp=UINPBA00004N"
    "url" => "/15178382/0000004700000003/v2_201704050113/S1517838216303070/v2_201704050113/en/main.assets"
  ]
  "en" => array:17 [
    "idiomaDefecto" => true
    "cabecera" => "<span class="elsevierStyleTextfn">Veterinary Microbiology</span>"
    "titulo" => "<span class="elsevierStyleItalic">Campylobacter</span> in broiler slaughter samples assessed by direct count on mCCDA and Campy-Cefex agar"
    "tieneTextoCompleto" => true
    "paginas" => array:1 [
      0 => array:2 [
        "paginaInicial" => "764"
        "paginaFinal" => "769"
      ]
    ]
    "autores" => array:1 [
      0 => array:4 [
        "autoresLista" => "Camila Cristina Gonsalves, Anderlise Borsoi, Gustavo Perdoncini, Laura Beatriz Rodrigues, Vladimir Pinheiro do Nascimento"
        "autores" => array:5 [
          0 => array:4 [
            "nombre" => "Camila Cristina"
            "apellidos" => "Gonsalves"
            "email" => array:1 [
              0 => "anderliseb&#64;yahoo&#46;com&#46;br"
            ]
            "referencia" => array:2 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">a</span>"
                "identificador" => "aff0005"
              ]
              1 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">&#42;</span>"
                "identificador" => "cor0005"
              ]
            ]
          ]
          1 => array:3 [
            "nombre" => "Anderlise"
            "apellidos" => "Borsoi"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">b</span>"
                "identificador" => "aff0010"
              ]
            ]
          ]
          2 => array:3 [
            "nombre" => "Gustavo"
            "apellidos" => "Perdoncini"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">a</span>"
                "identificador" => "aff0005"
              ]
            ]
          ]
          3 => array:3 [
            "nombre" => "Laura Beatriz"
            "apellidos" => "Rodrigues"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">c</span>"
                "identificador" => "aff0015"
              ]
            ]
          ]
          4 => array:3 [
            "nombre" => "Vladimir Pinheiro"
            "apellidos" => "do Nascimento"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">a</span>"
                "identificador" => "aff0005"
              ]
            ]
          ]
        ]
        "afiliaciones" => array:3 [
          0 => array:3 [
            "entidad" => "Centro de Diagn&#243;stico e Pesquisa em Patologia Avi&#225;ria &#40;CDPA&#41; &#8211; FAVET&#47;UFRGS &#8211; Lab&#46; Central &#8211; Porto Alegre&#44; RS&#44; Brazil"
            "etiqueta" => "a"
            "identificador" => "aff0005"
          ]
          1 => array:3 [
            "entidad" => "Departamento de Patologia Experimental e Comparada &#8211; Faculdade de Medicina Veterin&#225;ria e Zootecnia &#40;USP&#41;&#44; Brazil"
            "etiqueta" => "b"
            "identificador" => "aff0010"
          ]
          2 => array:3 [
            "entidad" => "Curso de Medicina Veterin&#225;ria da Faculdade de Agronomia e Medicina Veterin&#225;ria da Universidade de Passo Fundo &#40;UPF&#41;&#44; Brazil"
            "etiqueta" => "c"
            "identificador" => "aff0015"
          ]
        ]
        "correspondencia" => array:1 [
          0 => array:3 [
            "identificador" => "cor0005"
            "etiqueta" => "&#8270;"
            "correspondencia" => "<span class="elsevierStyleItalic">Corresponding author</span>&#46;"
          ]
        ]
      ]
    ]
    "textoCompleto" => "<span class="elsevierStyleSections"><span id="sec0005" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0015">Introduction</span><p id="par0005" class="elsevierStylePara elsevierViewall"><span class="elsevierStyleItalic">Campylobacter</span> bacteria are a major cause of foodborne illness in humans and are the most common gastroenteritis-causing bacteria in the world&#46; In both developed and developing countries&#44; they cause more cases of gastroenteritis than does foodborne <span class="elsevierStyleItalic">Salmonella</span>&#46; The high incidence of <span class="elsevierStyleItalic">Campylobacter</span> diarrhea and its duration and possible sequelae make it highly important from a socio-economic perspective&#46; In developing countries&#44; <span class="elsevierStyleItalic">Campylobacter</span> infections in children under the age of two are particularly frequent and occasionally result in death&#46;<a class="elsevierStyleCrossRef" href="#bib0135"><span class="elsevierStyleSup">1</span></a></p><p id="par0010" class="elsevierStylePara elsevierViewall">In the USA&#44; <span class="elsevierStyleItalic">Campylobacter</span> is the second most isolated agent of foodborne illness&#44;<a class="elsevierStyleCrossRef" href="#bib0140"><span class="elsevierStyleSup">2</span></a> and in the European Union &#40;EU&#41;&#44; <span class="elsevierStyleItalic">Campylobacter</span> is the main pathogen that causes human gastroenteritis&#44;<a class="elsevierStyleCrossRef" href="#bib0145"><span class="elsevierStyleSup">3</span></a> with approximately 198&#44;252 cases in 2009 alone&#46;<a class="elsevierStyleCrossRef" href="#bib0150"><span class="elsevierStyleSup">4</span></a></p><p id="par0015" class="elsevierStylePara elsevierViewall"><span class="elsevierStyleItalic">Campylobacter</span> bacteria can be spread by contaminated food and water&#44; and chicken was implicated as the main contamination source&#46;<a class="elsevierStyleCrossRef" href="#bib0155"><span class="elsevierStyleSup">5</span></a> During the poultry slaughtering process&#44; carcass contamination can occur not only by high bacterial loads present in the poultry&#39;s gastrointestinal tract but also by the bacterial loads present in skin and feathers&#46;<a class="elsevierStyleCrossRef" href="#bib0160"><span class="elsevierStyleSup">6</span></a> In addition to initial flock contamination&#44; hygienic and sanitary conditions during both the slaughtering process and carcass conservation can influence the presence and level of <span class="elsevierStyleItalic">Campylobacter</span> in the final product&#46;<a class="elsevierStyleCrossRef" href="#bib0165"><span class="elsevierStyleSup">7</span></a></p><p id="par0020" class="elsevierStylePara elsevierViewall">Broiler carcasses contaminated with <span class="elsevierStyleItalic">Campylobacter</span> have been detected in many countries&#46; A study conducted in Brazil<a class="elsevierStyleCrossRef" href="#bib0170"><span class="elsevierStyleSup">8</span></a> showed that 95 of the 96 broiler carcasses examined tested positive for <span class="elsevierStyleItalic">Campylobacter</span> at the end of the slaughter line&#46; According to the World Health Organization&#44;<a class="elsevierStyleCrossRef" href="#bib0175"><span class="elsevierStyleSup">9</span></a> reducing the prevalence or concentration at a specified point in the production chain has the potential to reduce the risk of human incidences if intervention is taken&#46;</p><p id="par0025" class="elsevierStylePara elsevierViewall">Quantitative microbial risk assessment is a well-recognized component of modern risk analysis and is used to estimate the impact of a particular hazard&#47;product combination and&#47;or changes in processing on public health&#46; In this regard&#44; two methods for <span class="elsevierStyleItalic">Campylobacter</span> quantification were published by leading authorities&#44; one by the International Standard Organization&#44; ISO-TS 10272-2&#44;<a class="elsevierStyleCrossRef" href="#bib0180"><span class="elsevierStyleSup">10</span></a> and another by the United States Department of Agriculture&#44; MLG 41&#46;02&#46;<a class="elsevierStyleCrossRef" href="#bib0185"><span class="elsevierStyleSup">11</span></a> The latter describes a method for direct plating and qualitative and quantitative evaluations using Campy-Cefex agar for the isolation&#44; identification and counting of <span class="elsevierStyleItalic">Campylobacter</span> spp&#46; present in rinsed poultry carcasses&#44; sponges and raw product samples&#46;</p><p id="par0030" class="elsevierStylePara elsevierViewall">The present study aimed to test the MLG 41&#46;02<a class="elsevierStyleCrossRef" href="#bib0185"><span class="elsevierStyleSup">11</span></a> methodology on carcass samples and in alternative matrices&#44; such as cloacal swabs and water samples&#44; from the broiler slaughtering process to compare the number of recovered <span class="elsevierStyleItalic">Campylobacter</span> cells on Campy-Cefex and mCCDA agar plates&#46;</p></span><span id="sec0010" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0020">Materials and methods</span><span id="sec0015" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0025">Sampling</span><p id="par0035" class="elsevierStylePara elsevierViewall">Samples were taken once a week from a slaughterhouse located in southern Brazil for four weeks in April 2013&#46; Each time&#44; three cloacal swabs and three samples from pre-chiller carcasses&#44; post-chiller carcasses&#44; pre chiller water&#44; chiller water and direct supply water were collected&#44; with 12 samples of each type and 72 in total&#46; The samples were placed immediately into thermic boxes with ice and sent to the laboratory for microbiological analysis&#46;</p></span><span id="sec0020" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0030">Quantitative and qualitative analysis</span><span id="sec0025" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0035">Controls</span><p id="par0040" class="elsevierStylePara elsevierViewall"><span class="elsevierStyleItalic">Campylobacter jejuni</span> ATCC 33291 and <span class="elsevierStyleItalic">Campylobacter coli</span> ATCC 43578 were used as positive controls for un-inoculated agar plates and broth sample sets&#46; One colony from each positive control sample was confirmed&#46;</p></span><span id="sec0030" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0040">Carcass rinse procedure</span><p id="par0045" class="elsevierStylePara elsevierViewall">Carcass samples were collected prior to placement in the pre-chiller tank on the evisceration line &#40;pre-chiller samples&#41; and immediately after the post-chiller &#40;post-chiller samples&#41;&#46;</p><p id="par0050" class="elsevierStylePara elsevierViewall">To perform quantitative analysis on the carcass rinse samples&#44; carcasses were put into sterile plastic bags with 400<span class="elsevierStyleHsp" style=""></span>mL of 1&#37; BPW &#40;1&#37; Buffered Peptone Water&#44; Oxoid<span class="elsevierStyleSup">&#174;</span>&#44; Basingstoke&#44; Hampshire&#44; UK&#41; and mixed thoroughly by gently shaking for 3<span class="elsevierStyleHsp" style=""></span>min&#46; From the rinse solution&#44; 250<span class="elsevierStyleHsp" style=""></span>&#956;L was streaked onto four Campy-Cefex agar plates with antimicrobial selective supplement &#40;SR0155&#44; Oxoid<span class="elsevierStyleSup">&#174;</span>&#44; Basingstoke&#44; Hampshire&#44; UK&#41; and 5&#37; sterile laked equine blood &#40;Ebefarma<span class="elsevierStyleSup">&#174;</span>&#44; Cachoeira de Macacu&#44; RJ&#44; Brazil&#41; using sterile glass Drigalski loops&#46; Another 100<span class="elsevierStyleHsp" style=""></span>&#956;L from the rinse solution was streaked onto two Campy-Cefex agar plates&#46; The procedure was performed in duplicate with streaking onto mCCDA agar plates containing an antimicrobial selective supplement &#40;SR0155 Oxoid<span class="elsevierStyleSup">&#174;</span>&#44; Basingstoke&#44; Hampshire&#44; UK&#41;&#46; The agar plates were incubated at 42<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>1&#46;0<span class="elsevierStyleHsp" style=""></span>&#176;C for 48<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>2<span class="elsevierStyleHsp" style=""></span>h under microaerobic conditions &#40;Microerobac&#44; Probac<span class="elsevierStyleSup">&#174;</span>&#44; S&#227;o Paulo&#44; SP&#44; Brazil&#41;&#46;</p><p id="par0055" class="elsevierStylePara elsevierViewall">To perform qualitative analysis&#44; 30<span class="elsevierStyleHsp" style=""></span>mL of the rinsing solution was added to 30<span class="elsevierStyleHsp" style=""></span>mL of double strength blood-free Bolton enrichment broth &#40;2X BF-BEB&#44; Oxoid&#174;&#44; Basingstoke&#44; Hampshire&#44; UK&#41; with selective supplement &#40;SRE183&#44; Oxoid<span class="elsevierStyleSup">&#174;</span> Basingstoke&#44; Hampshire&#44; UK&#41; and homogenized as described above&#46; After incubation&#44; 10<span class="elsevierStyleHsp" style=""></span>&#956;L from the BF-BEB was streaked onto Campy-Cefex and mCCDA agar plates and incubated under microaerobic conditions at 42<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>1&#46;0<span class="elsevierStyleHsp" style=""></span>&#176;C for 48<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>2<span class="elsevierStyleHsp" style=""></span>h&#46;</p></span><span id="sec0035" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0045">Cloacal swabs</span><p id="par0060" class="elsevierStylePara elsevierViewall">Swabs were collected during broiler hanging&#44; one swab per bird&#44; and stored in a 10<span class="elsevierStyleHsp" style=""></span>mL flask with 1&#37; BPW &#40;Oxoid<span class="elsevierStyleSup">&#174;</span> Basingstoke&#44; Hampshire&#44; UK&#41; at 4<span class="elsevierStyleHsp" style=""></span>&#176;C&#46; The tubes were homogenized&#44; and the quantitative analysis followed the same methodology as described above for the carcasses&#46; To perform the qualitative analysis&#44; 3<span class="elsevierStyleHsp" style=""></span>mL from the BPW homogenized solution was added to 30<span class="elsevierStyleHsp" style=""></span>mL of double strength blood-free Bolton enrichment broth &#40;2X BF-BEB&#44; Oxoid<span class="elsevierStyleSup">&#174;</span>&#44; Basingstoke&#44; Hampshire&#44; UK&#41; supplemented with a selective supplement &#40;SRE183&#44; Oxoid<span class="elsevierStyleSup">&#174;</span>&#44; Basingstoke&#44; Hampshire&#44; UK&#41; and analyzed as described above for the carcasses&#46;</p></span></span><span id="sec0040" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0050">Water samples</span><p id="par0065" class="elsevierStylePara elsevierViewall">Water samples from the pre chiller&#44; chiller and direct water supply were collected in 50<span class="elsevierStyleHsp" style=""></span>mL sterile flasks and stored at 4<span class="elsevierStyleHsp" style=""></span>&#176;C in the laboratory&#46; The water samples were homogenized and quantitative and qualitative analysis was performed as described above for the carcasses&#46;</p></span><span id="sec0045" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0055">Plate analysis and results</span><p id="par0070" class="elsevierStylePara elsevierViewall">After incubation&#44; all typical <span class="elsevierStyleItalic">Campylobacter</span> colonies were counted if the total number of cells fell within a range of 15&#8211;300 colonies&#46; The interpretation of typical colonies followed the instructions in the MLG 41&#46;02 protocol&#46;<a class="elsevierStyleCrossRef" href="#bib0185"><span class="elsevierStyleSup">11</span></a> Briefly&#44; if the four plates with 250<span class="elsevierStyleHsp" style=""></span>&#956;L were countable&#44; the sum of the counts from the four plates was determined&#46; If the only countable plates were the two plates with 100<span class="elsevierStyleHsp" style=""></span>&#956;L of sample&#44; the total number of cells on both plates was averaged and multiplied by ten&#46; If both dilutions were within the countable interval&#44; the final count was determined by averaging the results calculated above&#46; All cell count results are represented as CFU&#47;mL&#46; If the final count was &#62;300 CFU in each of the six plates&#44; &#8220;TNTC&#8221; &#40;to numerous to count&#41; was recorded&#44; or an estimated counting of &#62;2100<span class="elsevierStyleHsp" style=""></span>CFU&#47;mL was used&#46;<a class="elsevierStyleCrossRef" href="#bib0185"><span class="elsevierStyleSup">11</span></a></p></span><span id="sec0050" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0060">Examination and confirmation of colonies</span><p id="par0075" class="elsevierStylePara elsevierViewall">A typical colony from each sample was picked to confirm and test motility&#44; morphology&#44; oxidase and catalase activity &#40;Probac<span class="elsevierStyleSup">&#174;</span>&#44; S&#227;o Paulo&#44; SP&#44; Brazil&#41; and latex agglutination &#40;Dryspot&#44; DR0150&#44; Oxoid<span class="elsevierStyleSup">&#174;</span>&#44; Basingstoke&#44; Hampshire&#44; UK&#41;&#44; as described in MLG 41&#46;02&#46;<a class="elsevierStyleCrossRef" href="#bib0185"><span class="elsevierStyleSup">11</span></a> These colonies were also used for the polymerase chain reaction &#40;PCR&#41; technique &#40;see below&#41;&#46;</p></span><span id="sec0055" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0065">PCR methodology</span><p id="par0080" class="elsevierStylePara elsevierViewall"><span class="elsevierStyleItalic">Multiplex</span> PCR was performed as described by Perdoncini et al&#46;<a class="elsevierStyleCrossRef" href="#bib0190"><span class="elsevierStyleSup">12</span></a> to identify <span class="elsevierStyleItalic">C&#46; jejuni</span> and <span class="elsevierStyleItalic">C&#46; coli&#46;</span> Briefly&#44; 30<span class="elsevierStyleHsp" style=""></span>&#956;L reactions containing 10&#215; buffer&#44; 1&#46;5<span class="elsevierStyleHsp" style=""></span>mM MgCl<span class="elsevierStyleInf">2</span>&#44; 5<span class="elsevierStyleHsp" style=""></span>mM dNTPs&#44; two units of Taq polymerase&#44; thermo DNA extract&#44; 4<span class="elsevierStyleHsp" style=""></span>pmol&#47;&#956;L of each 16S rRNA primer&#44; 2<span class="elsevierStyleHsp" style=""></span>pmol&#47;&#956;L specific primers and ultra-pure water up to 30<span class="elsevierStyleHsp" style=""></span>&#956;L were made&#46; The specific primers used amplify the following genes&#58; <span class="elsevierStyleItalic">map</span>A &#40;<span class="elsevierStyleItalic">F</span><span class="elsevierStyleSup">a</span>&#8211;CTATTTTATTTTTGAGTGCTTGTG&#44; <span class="elsevierStyleItalic">R</span><span class="elsevierStyleSup">b</span>&#8211;GCTTTATTTGCCATTTGTTTTATTA with 589<span class="elsevierStyleHsp" style=""></span>pb&#44; 50<span class="elsevierStyleHsp" style=""></span>N&#41; &#40;Invitrogen<span class="elsevierStyleSup">&#174;</span>&#44; S&#227;o Paulo&#44; SP&#44; Brazil&#41; and <span class="elsevierStyleItalic">ceu</span>E &#40;<span class="elsevierStyleItalic">F</span><span class="elsevierStyleSup">a</span>&#8211;AATTGAAAATTGCTCCAACTATG&#44; <span class="elsevierStyleItalic">R</span><span class="elsevierStyleSup">b</span>&#8211;TGATTTTATTATTTGTAGCAGCG with 462<span class="elsevierStyleHsp" style=""></span>pb and a common region between species &#40;16S rRNA&#41;&#44; 50<span class="elsevierStyleHsp" style=""></span>N &#40;Invitrogen<span class="elsevierStyleSup">&#174;</span>&#44; S&#227;o Paulo&#44; SP&#44; Brazil&#41; and <span class="elsevierStyleItalic">F</span><span class="elsevierStyleSup">a</span>&#8211;ATCTAATGGCTTAACCATTAAAC&#44; <span class="elsevierStyleItalic">R</span><span class="elsevierStyleSup">b</span>&#8211;GGACGGTAACTAGTTTAGTATT with 857<span class="elsevierStyleHsp" style=""></span>pb&#44; 50<span class="elsevierStyleHsp" style=""></span>N &#40;Invitrogen<span class="elsevierStyleSup">&#174;</span>&#44; S&#227;o Paulo&#44; SP&#44; Brazil&#41;&#41;&#46; Amplification reactions were carried out in a thermal cycler &#40;Swift MaxPro<span class="elsevierStyleSup">&#174;</span>&#44; Esco&#44; Hatboro&#44; PA&#44; USA&#41; under the following conditions&#58; denaturation for 10<span class="elsevierStyleHsp" style=""></span>min at 95<span class="elsevierStyleHsp" style=""></span>&#176;C&#44; 35 cycles at 95<span class="elsevierStyleHsp" style=""></span>&#176;C for 30<span class="elsevierStyleHsp" style=""></span>s&#44; annealing at 59<span class="elsevierStyleHsp" style=""></span>&#176;C for 1<span class="elsevierStyleHsp" style=""></span>min and 30<span class="elsevierStyleHsp" style=""></span>s and a final extension at 72<span class="elsevierStyleHsp" style=""></span>&#176;C for 10<span class="elsevierStyleHsp" style=""></span>min&#46; <span class="elsevierStyleItalic">Arcobacter</span> spp&#46; were used as negative controls and <span class="elsevierStyleItalic">C&#46; jejuni</span> ATCC 33291 and <span class="elsevierStyleItalic">C&#46; coli</span> ATCC 43578 as positive controls&#46; Ten microliter aliquots of the reaction mixtures were electrophoresed through 1&#46;5&#37; agarose gels &#40;with the addition of 20&#37; ethidium bromide&#41; with a 100-bp DNA ladder &#40;Invitrogen<span class="elsevierStyleSup">&#174;</span>&#44; S&#227;o Paulo&#44; SP&#44; Brazil&#41; to determine the molecular weight&#46; Fragments were transilluminated with UV light&#46;</p></span><span id="sec0060" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0070">Data statistical analysis</span><p id="par0085" class="elsevierStylePara elsevierViewall">Data were submitted for ANOVA analysis using BioStat Version 2009 &#40;Analyst Soft&#46; Inc&#46;&#44; Alexandria&#44; VA&#44; USA&#41;&#46;</p></span></span><span id="sec0065" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0075">Results</span><p id="par0090" class="elsevierStylePara elsevierViewall">The <span class="elsevierStyleItalic">Campylobacter</span> direct plate count frequency was higher on the Campy-Cefex agar than on the mCCDA agar for different samples from broiler slaughtering process as described in <a class="elsevierStyleCrossRef" href="#tbl0005">Table 1</a>&#46;</p><elsevierMultimedia ident="tbl0005"></elsevierMultimedia><p id="par0095" class="elsevierStylePara elsevierViewall"><a class="elsevierStyleCrossRef" href="#tbl0010">Table 2</a> presents the results of quantitative analysis of <span class="elsevierStyleItalic">Campylobacter</span> spp&#46; directly counted on Campy-Cefex and mCCDA agar plates&#46;</p><elsevierMultimedia ident="tbl0010"></elsevierMultimedia><p id="par0100" class="elsevierStylePara elsevierViewall">There was a high frequency of <span class="elsevierStyleItalic">C&#46; jejuni</span> in all PCR-analyzed samples &#40;<a class="elsevierStyleCrossRef" href="#tbl0015">Table 3</a>&#41;&#46; In addition&#44; 18&#37; contained both <span class="elsevierStyleItalic">C&#46; jejuni</span> and <span class="elsevierStyleItalic">C&#46; coli</span> in the same sample&#46;</p><elsevierMultimedia ident="tbl0015"></elsevierMultimedia><p id="par0105" class="elsevierStylePara elsevierViewall">With respect to all PCR samples&#44; 2&#37; contained none of the specific genes used to identify <span class="elsevierStyleItalic">C&#46; jejuni</span> or <span class="elsevierStyleItalic">C&#46; coli</span>&#44; although they were identified as a C<span class="elsevierStyleItalic">ampylobacter</span> species&#46;</p></span><span id="sec0070" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0080">Discussion</span><p id="par0110" class="elsevierStylePara elsevierViewall"><span class="elsevierStyleItalic">Campylobacter</span> spp&#46; are recognized as a main cause of human enteritis outbreaks in both developed and developing countries&#46; Although Brazil is the world&#39;s largest poultry meat exporter&#44; data regarding this pathogen are limited&#44; and at present&#44; there is no legislation pertaining to <span class="elsevierStyleItalic">Campylobacter</span> risk analyses or control methods&#46;</p><p id="par0115" class="elsevierStylePara elsevierViewall">The <span class="elsevierStyleItalic">Campylobacter</span> isolation methodologies are laborious&#44; and there are many broths and agars available&#46; Some studies have evaluated the effectiveness of different broths and agar plates for their ability to isolate <span class="elsevierStyleItalic">Campylobacter</span> from several matrices to develop more efficient and lower cost methods&#46;<a class="elsevierStyleCrossRef" href="#bib0195"><span class="elsevierStyleSup">13</span></a> Oyarzabal et al&#46;<a class="elsevierStyleCrossRef" href="#bib0200"><span class="elsevierStyleSup">14</span></a> evaluated 240 samples of broiler carcass rinse samples by recovering <span class="elsevierStyleItalic">Campylobacter</span> on Campy-Cefex&#44; mCCDA and CLA &#40;Campy-Line agar&#41; agar plates&#46; The authors concluded that with regards to time&#44; preparation&#44; performance and cost&#44; Campy-Cefex and mCCDA agar obtained better <span class="elsevierStyleItalic">Campylobacter</span> counting results from carcass rinse samples&#46; In another poultry study<a class="elsevierStyleCrossRef" href="#bib0205"><span class="elsevierStyleSup">15</span></a> was compared five agar plates that were used to isolate <span class="elsevierStyleItalic">Campylobacter</span> as of cecal and fecal samples obtained from 60 broiler chicken&#46; The mCCA agar was more efficient at isolating the bacteria than the mCCDA&#44; CLA&#44; CAP &#40;<span class="elsevierStyleItalic">Campylobacter agar plates</span>&#41; and <span class="elsevierStyleItalic">Campylobacter</span> agars&#46;</p><p id="par0120" class="elsevierStylePara elsevierViewall">In the present study&#44; the quantitative methods from the MLG 41&#46;02<a class="elsevierStyleCrossRef" href="#bib0185"><span class="elsevierStyleSup">11</span></a> protocol showed reduced levels of <span class="elsevierStyleItalic">Campylobacter</span> in samples collected along the slaughter line&#44; from cloacal swabs from live birds to post chiller carcasses&#44; suggesting that the process of slaughtering can have a beneficial effect on the microbiological status of carcasses at the end of the slaughtering line&#46; Accordingly&#44; Berrang et al&#46;&#44;<a class="elsevierStyleCrossRef" href="#bib0210"><span class="elsevierStyleSup">16</span></a> reported that improved hygiene in the slaughtering process and constant evaluations of such hygiene measures allowed for a reduction in <span class="elsevierStyleItalic">Campylobacter</span> spp&#46; numbers in carcasses prior to shipping to markets&#46; Thus&#44; the number of bacteria from infected flocks can be reduced during processing in the slaughterhouse&#46;</p><p id="par0125" class="elsevierStylePara elsevierViewall">The presence of <span class="elsevierStyleItalic">Campylobacter</span> in the water supply samples &#40;<a class="elsevierStyleCrossRef" href="#tbl0005">Table 1</a>&#41; was not expected because chemical treatment of the water should eliminate bacteria&#59; further&#44; if bacteria were present&#44; a low level should not have been detected by a direct count method&#46; It is known that <span class="elsevierStyleItalic">Campylobacter</span> is able to compose biofilms and that their formation has been proposed as a survival mechanism outside the host for protection against chemical products&#44; physical cleaning processes and environmental stress&#44; among others&#46;<a class="elsevierStyleCrossRef" href="#bib0215"><span class="elsevierStyleSup">17</span></a> Thus&#44; the presence of biofilms and the contamination of the water sources are possible explanations for these data&#46;</p><p id="par0130" class="elsevierStylePara elsevierViewall">A high &#40;100&#37;&#41; prevalence of <span class="elsevierStyleItalic">Campylobacter</span> in cloacal swabs was also found in this study &#40;<a class="elsevierStyleCrossRef" href="#tbl0005">Table 1</a>&#41; by direct counting on both types of agar&#46; These data are in agreement with another study&#44;<a class="elsevierStyleCrossRef" href="#bib0220"><span class="elsevierStyleSup">18</span></a> who found that 96&#46;6&#37; from 30 samples of cloacal swabs contained <span class="elsevierStyleItalic">Campylobacter</span>&#46; Additionally&#44; Evans and Sayers<a class="elsevierStyleCrossRef" href="#bib0225"><span class="elsevierStyleSup">19</span></a> identified these bacteria in 91&#37; of chicken cloacal swabs &#40;20 total samples&#41; in Great Britain&#44; and Franchin et al&#46;<a class="elsevierStyleCrossRef" href="#bib0230"><span class="elsevierStyleSup">20</span></a> reported that 75&#37; of the swabs from broiler flocks in southern Brazil were positive for these bacteria&#46;</p><p id="par0135" class="elsevierStylePara elsevierViewall">Regarding carcass contamination&#44; we found <span class="elsevierStyleItalic">Campylobacter</span> contamination in 83&#37; of post-chiller carcasses&#44; and the isolation frequency by direct plate counting on Campy-Cefex agar was high &#40;<a class="elsevierStyleCrossRef" href="#tbl0005">Table 1</a>&#41;&#46; After enrichment in Bolton broth to boost low cell numbers in some samples&#44; all pre- and post-chiller carcass samples tested positive&#46; However&#44; these data were higher than those reported by the Europeans&#44; who had an average poultry carcass contamination level of 75&#46;8&#37;&#44;<a class="elsevierStyleCrossRef" href="#bib0235"><span class="elsevierStyleSup">21</span></a> and by Kuana et al&#46;&#44;<a class="elsevierStyleCrossRef" href="#bib0170"><span class="elsevierStyleSup">8</span></a> who reported that 98&#46;3&#37; of 60 broiler carcasses were contaminated after chiller processing&#46; In the present work&#44; a significant difference was found between the Campy-Cefex and mCCDA plates used for cell recovery in the analysis of pre-chiller carcass samples&#44; where Campy-Cefex had higher <span class="elsevierStyleItalic">Campylobacter</span> cell numbers &#40;<a class="elsevierStyleCrossRef" href="#tbl0010">Table 2</a>&#41;&#46; Furthermore&#44; it is important to note that despite the high isolation percentage from the Campy-Cefex agar&#44; no <span class="elsevierStyleItalic">C&#46; coli</span> was recovered in pre- and post-chiller carcass samples&#44; a fact that is not consistent with other matrices &#40;<a class="elsevierStyleCrossRef" href="#tbl0015">Table 3</a>&#41;&#46;</p><p id="par0140" class="elsevierStylePara elsevierViewall">Studies using direct plate counting methods have indicated that selective enrichment does not increase the recovery of <span class="elsevierStyleItalic">Campylobacter</span> from fecal or cecal samples or chicken carcasses&#46;<a class="elsevierStyleCrossRefs" href="#bib0240"><span class="elsevierStyleSup">22&#44;23</span></a> These data differ from the present study where 100&#37; of enriched samples were positive for <span class="elsevierStyleItalic">Campylobacter</span> spp&#46; Kiess et al&#46;<a class="elsevierStyleCrossRef" href="#bib0250"><span class="elsevierStyleSup">24</span></a> demonstrated that direct plating serves an advantage in isolating <span class="elsevierStyleItalic">Campylobacter</span> from poultry litter samples&#59; 37&#37; of the samples were positive for <span class="elsevierStyleItalic">Campylobacter</span> as tested by direct plating and 2&#37; were positive following enrichment&#46; Despite our higher <span class="elsevierStyleItalic">Campylobacter</span> frequency in enriched post-chiller samples&#44; the direct count method was able to recover and quantify <span class="elsevierStyleItalic">Campylobacter</span> in agreement with Oyarzabal et al&#46;&#44;<a class="elsevierStyleCrossRef" href="#bib0200"><span class="elsevierStyleSup">14</span></a> who demonstrated the value of direct plating in studying <span class="elsevierStyleItalic">Campylobacter</span> spp&#46; contamination of poultry carcasses&#46;</p><p id="par0145" class="elsevierStylePara elsevierViewall">Multiplex PCR analysis identified 72&#37; of samples as positive for <span class="elsevierStyleItalic">C&#46; jejuni</span> and 38&#37; as positive for <span class="elsevierStyleItalic">C&#46; coli</span> &#40;<a class="elsevierStyleCrossRef" href="#tbl0015">Table 3</a>&#41;&#46; Similar results were demonstrated in the European Union&#44; where 60&#46;8&#37; of cecal samples tested positive for <span class="elsevierStyleItalic">C&#46; jejuni</span> and 41&#46;5&#37; tested positive for <span class="elsevierStyleItalic">C&#46; coli</span>&#46;<a class="elsevierStyleCrossRef" href="#bib0235"><span class="elsevierStyleSup">21</span></a> In southern Brazil&#44; a study conducted by Perdoncini et al&#46;<a class="elsevierStyleCrossRef" href="#bib0190"><span class="elsevierStyleSup">12</span></a> sampled eight different points from a broiler slaughterhouse line&#46; They identified <span class="elsevierStyleItalic">C&#46; jejuni</span> in 75&#37; of the samples and <span class="elsevierStyleItalic">C&#46; coli</span> in 10&#37; of the samples&#46; In addition&#44; both <span class="elsevierStyleItalic">C&#46; jejuni</span> and <span class="elsevierStyleItalic">C coli</span> were present together in 15&#37; of all samples&#46; In contrast&#44; 200 samples of broiler cecal content from a southern Brazil slaughterhouse were evaluated&#44; and it was found that 44&#37; were positive for <span class="elsevierStyleItalic">C&#46; coli</span> and 2&#37; were positive for <span class="elsevierStyleItalic">C&#46; jejuni</span>&#46;<a class="elsevierStyleCrossRef" href="#bib0255"><span class="elsevierStyleSup">25</span></a></p><p id="par0150" class="elsevierStylePara elsevierViewall">Studies have also been performed with regards to the different <span class="elsevierStyleItalic">Campylobacter</span> serotypes colonizing birds&#46; Shibiny-El et al&#46;<a class="elsevierStyleCrossRef" href="#bib0260"><span class="elsevierStyleSup">26</span></a> reported that it is not common to isolate more than one type or subtype of <span class="elsevierStyleItalic">Campylobacter</span> from the same bird&#46; The authors suggest that <span class="elsevierStyleItalic">C&#46; jejuni</span> and <span class="elsevierStyleItalic">C&#46; coli</span> compete equally and showed a decline in <span class="elsevierStyleItalic">C&#46; jejuni</span> and <span class="elsevierStyleItalic">C&#46; coli</span> dominance in isolates from 35-day-old birds&#46; In contrast&#44; the present study&#44; as well as the study by Perdoncini et al&#46;&#44;<a class="elsevierStyleCrossRef" href="#bib0190"><span class="elsevierStyleSup">12</span></a> isolated two different serotypes from the same sample&#59; 18&#37; of the samples contained both <span class="elsevierStyleItalic">C&#46; jejuni</span> and <span class="elsevierStyleItalic">C&#46; coli</span>&#46; In fact&#44; both serotypes appeared in the same frequency in cloacal swabs&#46;</p><p id="par0155" class="elsevierStylePara elsevierViewall">In this work&#44; the ability to isolate <span class="elsevierStyleItalic">C&#46; coli</span> from different matrices by Campy-Cefex and mCCDA agar plates was variable &#40;<a class="elsevierStyleCrossRef" href="#tbl0015">Table 3</a>&#41;&#46; According to WHO&#44;<a class="elsevierStyleCrossRef" href="#bib0135"><span class="elsevierStyleSup">1</span></a> many different forms of media can be used in the recovery of <span class="elsevierStyleItalic">Campylobacter</span> spp&#46;&#44; and although mCCDA agar is the recommended medium&#44; alternatives may be used&#46; The main difference between media is the degree to which each inhibits contaminating flora&#44; but all selective agents allow for the growth of both <span class="elsevierStyleItalic">C&#46; jejuni</span> and <span class="elsevierStyleItalic">C&#46; coli</span>&#46;</p></span><span id="sec0075" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0085">Conclusions</span><p id="par0160" class="elsevierStylePara elsevierViewall">The direct plating methods applied in this study were able to recover <span class="elsevierStyleItalic">Campylobacter</span> from different poultry matrices&#46; Only from pre-chiller water did the Campy-Cefex agar direct counting method recover statistically high <span class="elsevierStyleItalic">Campylobacter</span> cells numbers&#46; Based on the results of this study&#44; it is plausible to suggest that both Campy-Cefex and mCCDA agar plates can increase the chances of recovering <span class="elsevierStyleItalic">C&#46; coli</span> from swabs&#44; carcasses and water samples&#46; The present work also demonstrated that direct counting of <span class="elsevierStyleItalic">Campylobacter</span> from samples at different sites in the broiler slaughterhouse is useful for identifying contamination points and levels and is a possible tool for controlling <span class="elsevierStyleItalic">Campylobacter</span> contamination at Brazilian slaughterhouses&#46;</p></span><span id="sec0080" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0090">Conflicts of interest</span><p id="par0165" class="elsevierStylePara elsevierViewall">The authors declare no conflicts of interest&#46;</p></span></span>"
    "textoCompletoSecciones" => array:1 [
      "secciones" => array:9 [
        0 => array:3 [
          "identificador" => "xres824751"
          "titulo" => "Abstract"
          "secciones" => array:1 [
            0 => array:1 [
              "identificador" => "abst0005"
            ]
          ]
        ]
        1 => array:2 [
          "identificador" => "xpalclavsec821208"
          "titulo" => "Keywords"
        ]
        2 => array:2 [
          "identificador" => "sec0005"
          "titulo" => "Introduction"
        ]
        3 => array:3 [
          "identificador" => "sec0010"
          "titulo" => "Materials and methods"
          "secciones" => array:7 [
            0 => array:2 [
              "identificador" => "sec0015"
              "titulo" => "Sampling"
            ]
            1 => array:3 [
              "identificador" => "sec0020"
              "titulo" => "Quantitative and qualitative analysis"
              "secciones" => array:3 [
                0 => array:2 [
                  "identificador" => "sec0025"
                  "titulo" => "Controls"
                ]
                1 => array:2 [
                  "identificador" => "sec0030"
                  "titulo" => "Carcass rinse procedure"
                ]
                2 => array:2 [
                  "identificador" => "sec0035"
                  "titulo" => "Cloacal swabs"
                ]
              ]
            ]
            2 => array:2 [
              "identificador" => "sec0040"
              "titulo" => "Water samples"
            ]
            3 => array:2 [
              "identificador" => "sec0045"
              "titulo" => "Plate analysis and results"
            ]
            4 => array:2 [
              "identificador" => "sec0050"
              "titulo" => "Examination and confirmation of colonies"
            ]
            5 => array:2 [
              "identificador" => "sec0055"
              "titulo" => "PCR methodology"
            ]
            6 => array:2 [
              "identificador" => "sec0060"
              "titulo" => "Data statistical analysis"
            ]
          ]
        ]
        4 => array:2 [
          "identificador" => "sec0065"
          "titulo" => "Results"
        ]
        5 => array:2 [
          "identificador" => "sec0070"
          "titulo" => "Discussion"
        ]
        6 => array:2 [
          "identificador" => "sec0075"
          "titulo" => "Conclusions"
        ]
        7 => array:2 [
          "identificador" => "sec0080"
          "titulo" => "Conflicts of interest"
        ]
        8 => array:1 [
          "titulo" => "References"
        ]
      ]
    ]
    "pdfFichero" => "main.pdf"
    "tienePdf" => true
    "fechaRecibido" => "2015-02-25"
    "fechaAceptado" => "2016-01-13"
    "PalabrasClave" => array:1 [
      "en" => array:1 [
        0 => array:4 [
          "clase" => "keyword"
          "titulo" => "Keywords"
          "identificador" => "xpalclavsec821208"
          "palabras" => array:5 [
            0 => "<span class="elsevierStyleItalic">Campylobacter</span>"
            1 => "Agar plate count"
            2 => "mCCDA"
            3 => "Campy-Cefex"
            4 => "Broiler"
          ]
        ]
      ]
    ]
    "tieneResumen" => true
    "resumen" => array:1 [
      "en" => array:2 [
        "titulo" => "Abstract"
        "resumen" => "<span id="abst0005" class="elsevierStyleSection elsevierViewall"><p id="spar0005" class="elsevierStyleSimplePara elsevierViewall"><span class="elsevierStyleItalic">Campylobacter</span> spp&#46; cause foodborne illnesses in humans primarily through the consumption of contaminated chicken&#46; The aim of this study was to evaluate the United States Department of Agriculture&#39;s &#40;USDA&#41; recommended methodology&#44; protocol MLG 41&#46;02&#44; for the isolation&#44; identification and direct plate counting of <span class="elsevierStyleItalic">Campylobacter jejuni</span> and <span class="elsevierStyleItalic">C&#46; coli</span> samples from the broiler slaughtering process&#46; A plating method using both mCCDA and Campy-Cefex agars is recommended to recover <span class="elsevierStyleItalic">Campylobacter</span> cells&#46; It is also possible to use this method in different matrices &#40;cloacal swabs and water samples&#41;&#46; Cloacal swabs&#44; samples from pre-chiller and post-chiller carcasses and samples of pre-chiller&#44; chiller and direct supply water were collected each week for four weeks from the same flock at a slaughterhouse located in an abattoir in southern Brazil&#46; Samples were analyzed to directly count <span class="elsevierStyleItalic">Campylobacter</span> spp&#46;&#44; and the results showed a high frequency of <span class="elsevierStyleItalic">Campylobacter</span> spp&#46; on Campy-Cefex agar&#46; For the isolated species&#44; 72&#37; were identified as <span class="elsevierStyleItalic">Campylobacter jejuni</span> and 38&#37; as <span class="elsevierStyleItalic">Campylobacter coli</span>&#46; It was possible to count <span class="elsevierStyleItalic">Campylobacter jejuni</span> and <span class="elsevierStyleItalic">Campylobacter coli</span> from different samples&#44; including the water supply samples&#44; using the two-agar method&#46; These results suggest that slaughterhouses can use direct counting methods with both agars and different matrices as a monitoring tool to assess the presence of <span class="elsevierStyleItalic">Campylobacter</span> bacteria in their products&#46;</p></span>"
      ]
    ]
    "multimedia" => array:3 [
      0 => array:8 [
        "identificador" => "tbl0005"
        "etiqueta" => "Table 1"
        "tipo" => "MULTIMEDIATABLA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "detalles" => array:1 [
          0 => array:3 [
            "identificador" => "at1"
            "detalle" => "Table "
            "rol" => "short"
          ]
        ]
        "tabla" => array:2 [
          "tablatextoimagen" => array:1 [
            0 => array:2 [
              "tabla" => array:1 [
                0 => """
                  <table border="0" frame="\n
                  \t\t\t\t\tvoid\n
                  \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><th class="td" title="table-head  " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">Sample&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</th><th class="td" title="table-head  " align="center" valign="top" scope="col" style="border-bottom: 2px solid black">Direct isolation<br>Agar Campy-Cefex &#40;&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</th><th class="td" title="table-head  " align="center" valign="top" scope="col" style="border-bottom: 2px solid black">Direct isolation<br>Agar mCCDA &#40;&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</th><th class="td" title="table-head  " align="center" valign="top" scope="col" style="border-bottom: 2px solid black">Enrichment broth and agar isolation<a class="elsevierStyleCrossRef" href="#tblfn0005"><span class="elsevierStyleSup">&#42;</span></a> &#40;&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</th><th class="td" title="table-head  " align="center" valign="top" scope="col" style="border-bottom: 2px solid black">Total of analyzed samples&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</th></tr></thead><tbody title="tbody"><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">Swabs&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">100&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">100&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">100&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">12&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">Carcasses pre-chiller&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">100&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">25&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">100&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">12&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">Pre-chiller water&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">100&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">75&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">100&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">12&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">Chiller water&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">100&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">66&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">100&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">12&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">Carcasses post-chiller&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">83&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">67&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">100&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">12&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">Water supply&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">100&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">50&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">100&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">12&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr></tbody></table>
                  """
              ]
              "imagenFichero" => array:1 [
                0 => "xTab1386595.png"
              ]
            ]
          ]
          "notaPie" => array:1 [
            0 => array:3 [
              "identificador" => "tblfn0005"
              "etiqueta" => "&#42;"
              "nota" => "<p class="elsevierStyleNotepara" id="npar0005">Bolton broth&#44; Campy-Cefex and mCCDA agars&#46;</p>"
            ]
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0010" class="elsevierStyleSimplePara elsevierViewall">Frequency of <span class="elsevierStyleItalic">Campylobacter</span> spp&#46; colonies directly isolated from mCCDA and Campy-Cefex agar plates with or without broth enrichment in different samples from the broiler slaughtering process&#46;</p>"
        ]
      ]
      1 => array:8 [
        "identificador" => "tbl0010"
        "etiqueta" => "Table 2"
        "tipo" => "MULTIMEDIATABLA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "detalles" => array:1 [
          0 => array:3 [
            "identificador" => "at2"
            "detalle" => "Table "
            "rol" => "short"
          ]
        ]
        "tabla" => array:2 [
          "tablatextoimagen" => array:1 [
            0 => array:2 [
              "tabla" => array:1 [
                0 => """
                  <table border="0" frame="\n
                  \t\t\t\t\tvoid\n
                  \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><th class="td" title="table-head  " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">Samples&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</th><th class="td" title="table-head  " align="center" valign="top" scope="col" style="border-bottom: 2px solid black">Agar Campy-Cefex<br>Average &#40;CFU&#47;mL&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</th><th class="td" title="table-head  " align="center" valign="top" scope="col" style="border-bottom: 2px solid black">Agar mCCDA<br>Average &#40;CFU&#47;mL&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</th><th class="td" title="table-head  " align="center" valign="top" scope="col" style="border-bottom: 2px solid black"><span class="elsevierStyleItalic">p</span><a class="elsevierStyleCrossRef" href="#tblfn0010"><span class="elsevierStyleSup">&#42;</span></a>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</th></tr></thead><tbody title="tbody"><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">Swabs&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">1&#46;3<span class="elsevierStyleHsp" style=""></span>&#215;<span class="elsevierStyleHsp" style=""></span>10<span class="elsevierStyleSup">3</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">9&#46;5<span class="elsevierStyleHsp" style=""></span>&#215;<span class="elsevierStyleHsp" style=""></span>10<span class="elsevierStyleSup">2</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">0&#46;307&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">Carcasses pre-chiller&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">9&#46;8<span class="elsevierStyleHsp" style=""></span>&#215;<span class="elsevierStyleHsp" style=""></span>10<span class="elsevierStyleSup">2</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">8&#46;3<span class="elsevierStyleHsp" style=""></span>&#215;<span class="elsevierStyleHsp" style=""></span>10<span class="elsevierStyleSup">1</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">0&#46;005&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">Pre-chiller water&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">1&#46;7<span class="elsevierStyleHsp" style=""></span>&#215;<span class="elsevierStyleHsp" style=""></span>10<span class="elsevierStyleSup">2</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">5&#46;4<span class="elsevierStyleHsp" style=""></span>&#215;<span class="elsevierStyleHsp" style=""></span>10<span class="elsevierStyleSup">2</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">0&#46;502&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">Chiller water&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">8&#46;0<span class="elsevierStyleHsp" style=""></span>&#215;<span class="elsevierStyleHsp" style=""></span>10<span class="elsevierStyleSup">2</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">3&#46;0<span class="elsevierStyleHsp" style=""></span>&#215;<span class="elsevierStyleHsp" style=""></span>10<span class="elsevierStyleSup">1</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">0&#46;139&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">Carcasses post chiller&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">1&#46;5<span class="elsevierStyleHsp" style=""></span>&#215;<span class="elsevierStyleHsp" style=""></span>10<span class="elsevierStyleSup">2</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">3&#46;8<span class="elsevierStyleHsp" style=""></span>&#215;<span class="elsevierStyleHsp" style=""></span>10<span class="elsevierStyleSup">1</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">0&#46;194&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">Water supply&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">7&#46;3<span class="elsevierStyleHsp" style=""></span>&#215;<span class="elsevierStyleHsp" style=""></span>10<span class="elsevierStyleSup">1</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">4&#46;7<span class="elsevierStyleHsp" style=""></span>&#215;<span class="elsevierStyleHsp" style=""></span>10<span class="elsevierStyleSup">0</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">0&#46;318&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr></tbody></table>
                  """
              ]
              "imagenFichero" => array:1 [
                0 => "xTab1386597.png"
              ]
            ]
          ]
          "notaPie" => array:1 [
            0 => array:3 [
              "identificador" => "tblfn0010"
              "etiqueta" => "&#42;"
              "nota" => "<p class="elsevierStyleNotepara" id="npar0010"><span class="elsevierStyleItalic">p</span><span class="elsevierStyleHsp" style=""></span>&#60;<span class="elsevierStyleHsp" style=""></span>0&#46;05&#44; statistically significant&#46;</p>"
            ]
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0015" class="elsevierStyleSimplePara elsevierViewall">Direct count averages of <span class="elsevierStyleItalic">Campylobacter</span> spp&#46; from Campy-Cefex and mCCDA agar plates plated with different samples from the broiler slaughtering process&#46;</p>"
        ]
      ]
      2 => array:8 [
        "identificador" => "tbl0015"
        "etiqueta" => "Table 3"
        "tipo" => "MULTIMEDIATABLA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "detalles" => array:1 [
          0 => array:3 [
            "identificador" => "at3"
            "detalle" => "Table "
            "rol" => "short"
          ]
        ]
        "tabla" => array:1 [
          "tablatextoimagen" => array:1 [
            0 => array:2 [
              "tabla" => array:1 [
                0 => """
                  <table border="0" frame="\n
                  \t\t\t\t\tvoid\n
                  \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><th class="td-with-role" title="table-head ; entry_with_role_rowhead " align="left" valign="top" scope="col">Samples&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</th><th class="td" title="table-head  " colspan="2" align="center" valign="top" scope="col" style="border-bottom: 2px solid black"><span class="elsevierStyleItalic">Campylobacter jejuni</span></th><th class="td" title="table-head  " colspan="2" align="center" valign="top" scope="col" style="border-bottom: 2px solid black"><span class="elsevierStyleItalic">Campylobacter coli</span></th></tr><tr title="table-row"><th class="td" title="table-head  " align="" valign="top" scope="col" style="border-bottom: 2px solid black">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</th><th class="td" title="table-head  " align="center" valign="top" scope="col" style="border-bottom: 2px solid black">Campy-Cefex&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</th><th class="td" title="table-head  " align="center" valign="top" scope="col" style="border-bottom: 2px solid black">mCCDA&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</th><th class="td" title="table-head  " align="center" valign="top" scope="col" style="border-bottom: 2px solid black">Campy-Cefex&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</th><th class="td" title="table-head  " align="center" valign="top" scope="col" style="border-bottom: 2px solid black">mCCDA&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</th></tr></thead><tbody title="tbody"><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">Swabs&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">12&#37;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">8&#37;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">10&#37;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">8&#37;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">Carcasses pre-chiller&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">8&#37;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">6&#37;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">&#8211;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">2&#37;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">Pre-chiller water&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">6&#37;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">6&#37;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">&#8211;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">&#8211;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">Chiller water&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">6&#37;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">2&#37;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">2&#37;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">&#8211;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">Carcasses post-chiller&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">4&#37;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">6&#37;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">&#8211;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">6&#37;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">Water supply&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">4&#37;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">&#8211;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">4&#37;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="table-entry  " align="char" valign="top">&#8211;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr></tbody></table>
                  """
              ]
              "imagenFichero" => array:1 [
                0 => "xTab1386596.png"
              ]
            ]
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0020" class="elsevierStyleSimplePara elsevierViewall">Percentage of isolated <span class="elsevierStyleItalic">Campylobacter jejuni</span> and <span class="elsevierStyleItalic">Campylobacter coli</span> on Campy-Cefex and mCCDA agar plates as identified by PCR analysis&#46;</p>"
        ]
      ]
    ]
    "bibliografia" => array:2 [
      "titulo" => "References"
      "seccion" => array:1 [
        0 => array:2 [
          "identificador" => "bibs0005"
          "bibliografiaReferencia" => array:26 [
            0 => array:3 [
              "identificador" => "bib0135"
              "etiqueta" => "1"
              "referencia" => array:1 [
                0 => array:1 [
                  "referenciaCompleta" => "WHO&#46; World Health Organization&#59; 2014&#46; Available at&#58; <a href="http://www.who.int/mediacentre/factsheets/fs255/en/">http&#58;&#47;&#47;www&#46;who&#46;int&#47;mediacentre&#47;factsheets&#47;fs255&#47;en&#47;</a> &#91;Accessed&#58; 24&#46;11&#46;2014&#93;&#46;"
                ]
              ]
            ]
            1 => array:3 [
              "identificador" => "bib0140"
              "etiqueta" => "2"
              "referencia" => array:1 [
                0 => array:1 [
                  "referenciaCompleta" => "CDC&#46; Preliminary FoodNet data on the incidence of infection with pathogens transmitted commonly through food &#8211; 10 States&#46; Morbidity and Mortality Weekly Report&#44; v&#46; 19&#44; n&#46; 14&#44; 2010&#44; p&#46; 418&#8211;422&#46; Available at&#58; <a href="http://www.cdc.gov/mmwr/pdf/wk/mm5914.pdf">http&#58;&#47;&#47;www&#46;cdc&#46;gov&#47;mmwr&#47;pdf&#47;wk&#47;mm5914&#46;pdf</a>&#46; &#91;Accessed 15&#46;07&#46;2014&#93;&#46;"
                ]
              ]
            ]
            2 => array:3 [
              "identificador" => "bib0145"
              "etiqueta" => "3"
              "referencia" => array:1 [
                0 => array:3 [
                  "comentario" => "p&#46; 1503"
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Analysis of the baseline survey on the prevalence of <span class="elsevierStyleItalic">Campylobacter</span> on broiler batches and of <span class="elsevierStyleItalic">Campylobacter</span> and <span class="elsevierStyleItalic">Salmonella</span> on broiler carcasses in the EU&#46; Part A&#58; <span class="elsevierStyleItalic">Campylobacter</span> and <span class="elsevierStyleItalic">Salmonella</span> prevalence estimates"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:1 [
                            0 => "EFSA&#46; European Food Safety Authority"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:4 [
                        "tituloSerie" => "EFSA J"
                        "fecha" => "2009"
                        "volumen" => "8"
                        "numero" => "3"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            3 => array:3 [
              "identificador" => "bib0150"
              "etiqueta" => "4"
              "referencia" => array:1 [
                0 => array:1 [
                  "referenciaCompleta" => "EFSA&#46; European Food Safety Authority&#46; Reducing <span class="elsevierStyleItalic">Campylobacter</span> in EU chickens&#59; 2011&#46; Available at&#58; <a href="http://www.foodprocessing.com.au/articles/46692-Reducing-Campylobacter-in-EU-chickens">http&#58;&#47;&#47;www&#46;foodprocessing&#46;com&#46;au&#47;articles&#47;46692-Reducing-<span class="elsevierStyleItalic">Campylobacter</span>-in-EU-chickens</a> &#91;Accessed 10&#46;03&#46;2014&#93;&#46;"
                ]
              ]
            ]
            4 => array:3 [
              "identificador" => "bib0155"
              "etiqueta" => "5"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "<span class="elsevierStyleItalic">Campylobacter</span> in primary animal production and control strategies to reduce the burden of human campylobacteriosis"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:3 [
                            0 => "J&#46;A&#46; Wagenaar"
                            1 => "D&#46;J&#46; Mevius"
                            2 => "A&#46;H&#46; Havelaar"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:6 [
                        "tituloSerie" => "Rev Sci Tech Off Int Epiz"
                        "fecha" => "2006"
                        "volumen" => "25"
                        "numero" => "2"
                        "paginaInicial" => "581"
                        "paginaFinal" => "594"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            5 => array:3 [
              "identificador" => "bib0160"
              "etiqueta" => "6"
              "referencia" => array:1 [
                0 => array:1 [
                  "referenciaCompleta" => "Boufleur R&#46; <span class="elsevierStyleItalic">Campylobacter jejuni</span> em Frangos de Corte&#44; Carne e V&#237;sceras de Frango no Rio Grande do Sul e Efeito do Congelamento sobre a Contamina&#231;&#227;o nos Cortes&#46; Santa Maria&#44; RS&#44; Brasil&#59; 2009&#44; 47p&#46; &#40;M&#46;Sc&#46; Dissertation&#46; Centro de Ci&#234;ncias Rurais&#46; UFSM&#41;&#46;"
                ]
              ]
            ]
            6 => array:3 [
              "identificador" => "bib0165"
              "etiqueta" => "7"
              "referencia" => array:1 [
                0 => array:1 [
                  "referenciaCompleta" => "Fonseca BB&#46; Transmiss&#227;o vertical de Campylobacter sp em um sistema de produ&#231;&#227;o av&#237;cola&#46; Uberl&#226;ndia&#44; MG&#44; Brasil&#59; 2006&#46; 80p&#46; &#40;M&#46;Sc&#46; Dissertation&#46; Universidade Federal de Uberl&#226;ndia&#41;&#46;"
                ]
              ]
            ]
            7 => array:3 [
              "identificador" => "bib0170"
              "etiqueta" => "8"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Occurrence and characterization of <span class="elsevierStyleItalic">Campylobacter</span> in the Brazilian production and processing of broilers"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:3 [
                            0 => "S&#46;L&#46; Kuana"
                            1 => "L&#46;R&#46; Santos"
                            2 => "L&#46;B&#46; Rodrigues"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1637/8296-032608-Reg.1"
                      "Revista" => array:7 [
                        "tituloSerie" => "Avian Diseases"
                        "fecha" => "2008"
                        "volumen" => "52"
                        "numero" => "4"
                        "paginaInicial" => "680"
                        "paginaFinal" => "684"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/19166063"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            8 => array:3 [
              "identificador" => "bib0175"
              "etiqueta" => "9"
              "referencia" => array:1 [
                0 => array:1 [
                  "referenciaCompleta" => "FAO&#47;WHO&#46; Technical meeting on Salmonella and Campylobacter in chicken meat&#59; 2009&#46; URL&#58; <a href="http://www.who.int/foodsafety/publications/micro/MRA19.pdf">http&#58;&#47;&#47;www&#46;who&#46;int&#47;foodsafety&#47;publications&#47;micro&#47;MRA19&#46;pdf</a>&#46;"
                ]
              ]
            ]
            9 => array:3 [
              "identificador" => "bib0180"
              "etiqueta" => "10"
              "referencia" => array:1 [
                0 => array:1 [
                  "referenciaCompleta" => "ISO 10272-1&#58;2006&#46; Microbiology of food and animal feeding stuffs &#8211; Horizontal method for detection and enumeration of <span class="elsevierStyleItalic">Campylobacter</span> spp&#46;"
                ]
              ]
            ]
            10 => array:3 [
              "identificador" => "bib0185"
              "etiqueta" => "11"
              "referencia" => array:1 [
                0 => array:1 [
                  "referenciaCompleta" => "USDA&#46; MLG 41&#46;02&#46; 2013&#46; In&#58; isolation&#44; identification and enumeration of <span class="elsevierStyleItalic">Campylobacter jejuni</span>&#47;<span class="elsevierStyleItalic">coli</span>&#47;<span class="elsevierStyleItalic">lari</span> from poultry rinse&#44; sponge and raw product samples&#59; 2014&#46; Available at&#58; <a href="http://www.fsis.usda.gov/wps/wcm/connect/0273bc3d-2363-45b3-befb-1190c25f3c8b/MLG-41.pdf?MOD=AJPERES">http&#58;&#47;&#47;www&#46;fsis&#46;usda&#46;gov&#47;wps&#47;wcm&#47;connect&#47;0273bc3d-2363-45b3-befb-1190c25f3c8b&#47;MLG-41&#46;pdf&#63;MOD&#61;AJPERES</a>&#46; &#91;Accessed 14&#46;07&#46;2014&#93;&#46;"
                ]
              ]
            ]
            11 => array:3 [
              "identificador" => "bib0190"
              "etiqueta" => "12"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Identifica&#231;&#227;o de <span class="elsevierStyleItalic">Campylobacter jejuni</span> e <span class="elsevierStyleItalic">Campylobacter coli</span> de origem av&#237;cola atrav&#233;s do ensaio multiplex PCR"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:3 [
                            0 => "G&#46; Perdoncini"
                            1 => "T&#46; Tejkowski"
                            2 => "Y&#46; Sierra-Arguello"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "LibroEditado" => array:2 [
                        "titulo" => "III Congresso Sul Brasileiro de Avicultura&#44; Suinocultura e Latic&#237;nios"
                        "serieFecha" => "2012"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            12 => array:3 [
              "identificador" => "bib0195"
              "etiqueta" => "13"
              "referencia" => array:1 [
                0 => array:3 [
                  "comentario" => "Available at&#58; <span class="elsevierStyleInterRef" id="intr0030" href="http://pt.engormix.com/MA-avicultura/54%20administracao/artigos/campylobacter-produtos-avicolas-sua-t777/124-p0.htm">http&#58;&#47;&#47;pt&#46;engormix&#46;com&#47;MA-avicultura&#47;54 administracao&#47;artigos&#47;campylobacter-produtos-avicolas-sua-t777&#47;124-p0&#46;htm</span>&#46; &#91;Accessed 03&#46;08&#46;2014&#93;&#46;"
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Campylobacter em produtos av&#237;colas e sua import&#226;ncia na sa&#250;de p&#250;blica"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:2 [
                            0 => "A&#46; Borsoi"
                            1 => "V&#46;P&#46; Nascimento"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Libro" => array:1 [
                        "fecha" => "2011"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            13 => array:3 [
              "identificador" => "bib0200"
              "etiqueta" => "14"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Evaluation of agar plates for direct enumeration of <span class="elsevierStyleItalic">Campylobacter</span> spp&#46; from poultry carcass rinses"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:4 [
                            0 => "A&#46;O&#46; Oyarzabal"
                            1 => "K&#46;S&#46; Macklin"
                            2 => "J&#46;M&#46; Barbaree"
                            3 => "R&#46;S&#46; Miller"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1128/AEM.71.6.3351-3354.2005"
                      "Revista" => array:6 [
                        "tituloSerie" => "Appl Environ Microbiol"
                        "fecha" => "2005"
                        "volumen" => "71"
                        "paginaInicial" => "3351"
                        "paginaFinal" => "3354"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/15933040"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            14 => array:3 [
              "identificador" => "bib0205"
              "etiqueta" => "15"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Evaluation of different plate media for direct cultivation of <span class="elsevierStyleItalic">Campylobacter</span> species from live broilers"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:3 [
                            0 => "L&#46;P&#46; Potturi-Venkata"
                            1 => "S&#46; Backert"
                            2 => "A&#46;J&#46; Lastovica"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:5 [
                        "tituloSerie" => "Poultry Sci"
                        "fecha" => "2007"
                        "volumen" => "86"
                        "paginaInicial" => "1304"
                        "paginaFinal" => "1311"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            15 => array:3 [
              "identificador" => "bib0210"
              "etiqueta" => "16"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Prevalence and numbers of <span class="elsevierStyleItalic">Campylobacter</span> on broiler carcasses collected at rehang and postchill in 20 U&#46;S&#46; processing plants"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:3 [
                            0 => "M&#46;E&#46; Berrang"
                            1 => "J&#46; Bailey"
                            2 => "S&#46; Altekruse"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:6 [
                        "tituloSerie" => "J Food Protect"
                        "fecha" => "2007"
                        "volumen" => "70"
                        "numero" => "7"
                        "paginaInicial" => "1556"
                        "paginaFinal" => "1560"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            16 => array:3 [
              "identificador" => "bib0215"
              "etiqueta" => "17"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "<span class="elsevierStyleItalic">Campylobacter jejuni</span> as a secondary colonizer of poultry biofilms"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:3 [
                            0 => "Hanning"
                            1 => "R&#46; Jarquin"
                            2 => "M&#46; Slavik"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1111/j.1365-2672.2008.03853.x"
                      "Revista" => array:6 [
                        "tituloSerie" => "J Appl Microbiol"
                        "fecha" => "2008"
                        "volumen" => "105"
                        "paginaInicial" => "1199"
                        "paginaFinal" => "1208"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/18557961"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            17 => array:3 [
              "identificador" => "bib0220"
              "etiqueta" => "18"
              "referencia" => array:1 [
                0 => array:1 [
                  "referenciaCompleta" => "Chaves SOC&#46; Pesquisa de <span class="elsevierStyleItalic">Campylobacter</span> spp&#46; em granjas e abatedouro av&#237;colas na mesorregi&#227;o metropolitana de Bel&#233;m &#8211; PA&#46; &#40;M&#46;Sc&#46; Dissertation&#46; Universidade Federal do Par&#225;&#41;&#59; 2003&#46;"
                ]
              ]
            ]
            18 => array:3 [
              "identificador" => "bib0225"
              "etiqueta" => "19"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "A longitudinal study of <span class="elsevierStyleItalic">Campylobacter</span> infection of broiler flocks in Great Britain"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:2 [
                            0 => "S&#46;J&#46; Evans"
                            1 => "A&#46;R&#46; Sayers"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:5 [
                        "tituloSerie" => "Preventive Veterinary Med"
                        "fecha" => "2000"
                        "volumen" => "46"
                        "paginaInicial" => "209"
                        "paginaFinal" => "223"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            19 => array:3 [
              "identificador" => "bib0230"
              "etiqueta" => "20"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Sources of poultry meat contamination with thermophilic <span class="elsevierStyleItalic">Campylobacter</span> before slaughter"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:3 [
                            0 => "P&#46;R&#46; Franchin"
                            1 => "K&#46;E&#46; Aidoo"
                            2 => "C&#46;R&#46;V&#46; Batista"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:5 [
                        "tituloSerie" => "Brazilian J Microbiol"
                        "fecha" => "2005"
                        "volumen" => "36"
                        "paginaInicial" => "157"
                        "paginaFinal" => "162"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            20 => array:3 [
              "identificador" => "bib0235"
              "etiqueta" => "21"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Analysis of the baseline survey on the prevalence of <span class="elsevierStyleItalic">Campylobacter</span> on broiler batches and of <span class="elsevierStyleItalic">Campylobacter</span> and <span class="elsevierStyleItalic">Salmonella</span> on broiler carcasses in the EU&#44; 2009&#46; Part A&#58; <span class="elsevierStyleItalic">Campylobacter</span> and <span class="elsevierStyleItalic">Salmonella</span> prevalence estimates"
                      "autores" => array:1 [
                        0 => array:3 [
                          "colaboracion" => "European Food Safety Authority"
                          "etal" => false
                          "autores" => array:1 [
                            0 => "EFSA"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:5 [
                        "tituloSerie" => "EFSA J"
                        "fecha" => "2010"
                        "volumen" => "8"
                        "numero" => "3"
                        "paginaInicial" => "1503"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            21 => array:3 [
              "identificador" => "bib0240"
              "etiqueta" => "22"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Selective enrichment broth medium for isolation of <span class="elsevierStyleItalic">Campylobacter jejuni</span>"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:5 [
                            0 => "W&#46;T&#46; Martin"
                            1 => "M&#46;C&#46; Patton"
                            2 => "G&#46;K&#46; Morris"
                            3 => "M&#46;E&#46; Potter"
                            4 => "N&#46;D&#46; Puhr"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:7 [
                        "tituloSerie" => "J Clin Microbiol"
                        "fecha" => "1983"
                        "volumen" => "17"
                        "numero" => "5"
                        "paginaInicial" => "853"
                        "paginaFinal" => "855"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/6863504"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            22 => array:3 [
              "identificador" => "bib0245"
              "etiqueta" => "23"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Detection of <span class="elsevierStyleItalic">Campylobacter</span> spp&#46; in ceca and crops with and without enrichment"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:5 [
                            0 => "M&#46;T&#46; Musgrove"
                            1 => "M&#46;E&#46; Berrang"
                            2 => "J&#46;A&#46; Byrd"
                            3 => "N&#46;J&#46; Stern"
                            4 => "N&#46;A&#46; Cox"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:5 [
                        "tituloSerie" => "Poultry Sci"
                        "fecha" => "2001"
                        "volumen" => "80"
                        "paginaInicial" => "825"
                        "paginaFinal" => "828"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            23 => array:3 [
              "identificador" => "bib0250"
              "etiqueta" => "24"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Evaluation of different selective media and culturing techniques for the quantification of <span class="elsevierStyleItalic">Campylobacter</span> spp&#46; from broiler litter"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:3 [
                            0 => "A&#46;S&#46; Kiess"
                            1 => "H&#46;M&#46; Parker"
                            2 => "C&#46;D&#46; Mcdaniel"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:5 [
                        "tituloSerie" => "Poultry Sci"
                        "fecha" => "2010"
                        "volumen" => "89"
                        "paginaInicial" => "1755"
                        "paginaFinal" => "1762"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            24 => array:3 [
              "identificador" => "bib0255"
              "etiqueta" => "25"
              "referencia" => array:1 [
                0 => array:1 [
                  "referenciaCompleta" => "BIOTECSUR&#46; Informe Descritivo Final&#46; 2013&#46; Available at&#58; <a href="http://www.biotecsur.org/proyectosregionales/informe_final_pi_atecnica_internacional.pdf">http&#58;&#47;&#47;www&#46;biotecsur&#46;org&#47;proyectosregionales&#47;informe&#95;final&#95;pi&#95;atecnica&#95;internacional&#46;pdf</a>&#46; &#91;Accessed&#58; 30 &#46;03&#46;2014&#93;&#46;"
                ]
              ]
            ]
            25 => array:3 [
              "identificador" => "bib0260"
              "etiqueta" => "26"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "<span class="elsevierStyleItalic">Campylobacter</span> succession in broiler chickens"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:3 [
                            0 => "S&#46;A&#46; Shibiny-El"
                            1 => "P&#46;L&#46; Connerton"
                            2 => "I&#46;F&#46; Connerto"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:5 [
                        "tituloSerie" => "Microbiol Vet"
                        "fecha" => "2007"
                        "volumen" => "125"
                        "paginaInicial" => "323"
                        "paginaFinal" => "332"
                      ]
                    ]
                  ]
                ]
              ]
            ]
          ]
        ]
      ]
    ]
  ]
  "idiomaDefecto" => "en"
  "url" => "/15178382/0000004700000003/v2_201704050113/S151783821630288X/v2_201704050113/en/main.assets"
  "Apartado" => array:4 [
    "identificador" => "47984"
    "tipo" => "SECCION"
    "en" => array:2 [
      "titulo" => "Veterinary Microbiology"
      "idiomaDefecto" => true
    ]
    "idiomaDefecto" => "en"
  ]
  "PDF" => "https://static.elsevier.es/multimedia/15178382/0000004700000003/v2_201704050113/S151783821630288X/v2_201704050113/en/main.pdf?idApp=UINPBA00004N&text.app=https://www.elsevier.es/"
  "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S151783821630288X?idApp=UINPBA00004N"
]
Article information
ISSN: 15178382
Original language: English
The statistics are updated each day
Year/Month Html Pdf Total
2024 October 19 2 21
2024 September 13 0 13
2024 August 14 1 15
2024 July 14 3 17
2024 June 10 2 12
2024 May 17 3 20
2024 April 11 6 17
2024 March 13 5 18
2024 February 14 11 25
2024 January 19 4 23
2023 December 29 4 33
2023 November 39 3 42
2023 October 19 2 21
2023 September 6 2 8
2023 August 18 2 20
2023 July 16 7 23
2023 June 9 0 9
2023 May 11 3 14
2023 April 4 0 4
2023 March 16 4 20
2023 February 11 2 13
2023 January 9 5 14
2022 December 8 6 14
2022 November 10 7 17
2022 October 10 5 15
2022 September 8 20 28
2022 August 12 12 24
2022 July 19 41 60
2022 June 28 16 44
2022 May 27 4 31
2022 April 28 7 35
2022 March 21 7 28
2022 February 23 7 30
2022 January 25 8 33
2021 December 37 10 47
2021 November 41 15 56
2021 October 31 23 54
2021 September 54 6 60
2021 August 61 51 112
2021 July 15 17 32
2021 June 13 12 25
2021 May 8 3 11
2021 April 19 15 34
2021 March 8 14 22
2021 February 7 15 22
2021 January 8 16 24
2020 December 6 16 22
2020 November 7 6 13
2020 October 1 7 8
2020 September 8 8 16
2020 August 6 7 13
2020 July 8 8 16
2020 June 5 4 9
2020 May 2 7 9
2020 April 5 2 7
2020 March 3 0 3
2020 February 8 1 9
2020 January 4 2 6
2019 December 12 4 16
2019 November 6 1 7
2019 October 1 0 1
2019 September 2 1 3
2019 August 1 0 1
2019 July 3 3 6
2019 June 9 0 9
2019 May 31 6 37
2018 November 17 13 30
2018 October 6 14 20
2018 September 21 15 36
2018 August 9 8 17
2018 July 12 7 19
2018 June 9 13 22
2018 May 11 10 21
2018 April 20 13 33
2018 March 13 5 18
2018 February 6 9 15
2018 January 7 8 15
2017 December 12 10 22
2017 November 14 11 25
2017 October 9 11 20
2017 September 9 8 17
2017 August 9 7 16
2017 July 21 15 36
2017 June 34 9 43
2017 May 26 12 38
2017 April 24 17 41
2017 March 15 11 26
2017 February 8 8 16
2017 January 17 9 26
2016 December 26 25 51
2016 November 18 15 33
2016 October 20 19 39
2016 September 34 20 54
2016 August 55 19 74
2016 July 38 27 65
Show all

Follow this link to access the full text of the article